Home.teletu.it

Dental Research Journal
Original Article
Titanium nanotubes stimulate osteoblast differentiation of stem
cells from pulp and adipose tissue
Alfonso Pozio1, Annalisa Palmieri2, Ambra Girardi3, Francesca Cura3, Francesco Carinci2
1ENEA, IDROCOMB, C.R. Casaccia, Rome, 2Department of Medical-Surgical Sciences of Communication and Behavior, Section of Maxillofacial and
Plastic Surgery, University of Ferrara, Ferrara, 3Histology, Embryology and Applied Biology, Centre of Molecular Genetics, CARISBO Foundation, University of Bologna, Bologna, Italy ABSTRACT
Background: Titanium is the gold standard among materials used for prosthetic devices because
Received: June 2012
of its good mechanical and chemical properties. When exposed to oxygen, titanium becomes an Accepted: August 2012
oxide, anatase that is biocompatible and able to induce osseointegration.
Address for correspondence:
Materials and Methods: In this study we compared the expression profiling of stem cells
Prof. Francesco Carinci, cultivated on two types of surface: Pure titanium disk and nanotube titanium disk in order to detect Department of Medical-Surgical Sciences of if nanotube titanium instead (NTD) surface stimulates stem cells towards osteoblast differentiation.
Communication and Results: Stem cells cultivated on nanotube titanium disks showed the upregulation of bone‑related
Behavior, Section of genes RUNX2, FOSL1 and SPP1.
Maxillofacial and Plastic Conclusions: Results demonstrated that nanotube titanium disk surface is more osteo‑induced surface
Surgery University of Ferrara, Corso Giovecca 203, compared to titanium disk, promoting the differentiation of mesenchymal stem cells in osteoblasts.
44100 Ferrara, Italy.
E‑mail: [email protected]
Key Words: Gene expression, nanotubes, osteoblasts, stem cells, titanium disks
of its structure, morphology and composition.[10] Normally on the surface of the prosthesis made Pure titanium and titanium alloys are materials widely of titanium is present a stochastic distribution of used in orthopedic and dental surgery because of their two titanium‑oxide (rutile and anatase), which are desirable mechanical properties, chemical stability and responsible for the properties of the material.[10] biocompatibility.[1] Several authors studied different In biomedical implants, the anatase phase shows characteristics of implant morphology in order to an enhanced ability to induce bone‑like apatite in value their impact on implant stability.[2‑8] Indeed comparison with the rutile phase.[10] titanium is used to manufacture joint prosthesis for partial and total joint replacement. Moreover, Various physical and chemical treatments of the titanium is also used to produce plates and screws for titanium surface have been proposed with a view to osteo‑synthesis of fractures and for dental implants to obtaining the most biocompatible one.[10] substitute lost teeth.[9] We focused our interest on anatase titanium disks. The biocompatibility of titanium is closely related These surfaces have been used as substrate for the to the properties of the surface oxide layer, in terms nanotubes growth, to implement their characteristics Access this article online
Tissue replacement by culturing autologous cells onto three‑dimensional matrixes that facilitate cell progenitor migration, proliferation and differentiation[11] is one of the most promising bone regeneration techniques.
Stem cells are undifferentiated cells with the capability to regenerate into one or more committed Dental Research Journal / Dec 2012 / Vol 9 / Issue 8 (Supplement Issue 2) Pozio, et al.: Titanium disks and osteoblasts differentiation cell lineages. Stem cells isolated from multiple growth. The disks have diameter of 30 mm with sources have been finding widespread use to advance a thickness of 0.5 mm, and were arranged to show the field of tissue repair.[12] an active area of 3.8 cm2. After 3 min. pickling in a Dental pulp is a niche housing neural‑crest‑derived HF (Carlo Erba)/HNO (Carlo Erba) solution, made stem cells that display plasticity and multipotential by a volumetric ratio of 1:3 and diluted in deionized capability. This niche is easily accessible and there water until 100 ml, all the titanium sheets have been is limited morbidity of the anatomical site after set in three‑electrode cell, containing a KOH 1 M collection of the pulp.[13] solution (Carlo Erba) and subjected to a prefixed and optimized density current (1 mA/cm2), which Dental pulp stem cells (DPSCs) display noticeable is generated by a Potentiostat/Galvanostat Solartron plasticity that is explained by their neural‑crest 1286 for 3 min. The counter‑electrode is a Platinum origin.[14] They can extensively proliferate and sheet, while the reference is a standard calomel differentiate into odontoblastic, adipogenic and neural electrode (SCE). The growth of the nanotube arrays citotype, have a long lifespan and build in vivo an has been made using a Glycol Ethylene solution adult bone with Havers channels and an appropriate with 1 %wt. H O and 0.2%wt. NH F for 3 h at 60 V. After the anodization treatment, all the samples are Adipose tissue is another ideal source of autologous washed in glycol ethylene, left overnight in the dry stem cells because it is easily obtainable by room, in order to dry them. So to crystallize the TiO2 lipoaspiration, and its mesenchymal stem nanotubes, obtained in amorphous form by anodic cells (MSCs) content is adequate for clinical‑grade growth, after a pre‑heat treatment at 80°C in vacuum cell manipulation in regenerative medicine.
for 3 h, all the samples have been placed in a tubular These cells, that display a fibroblast‑like morphology furnace (Lenton) for 1 h at 580°C, with a slope of and lack intracellular lipid droplets seen in 1°C/min. in air, so as to be transformed into the adipocytes,[16] can be enzymatically digested out anatase phase.
of adipose tissue and separated from the buoyant DPSCs isolation
adipocytes by centrifugation.
Dental germ pulp was extracted from third molars of A more homogeneous population emerges in culture healthy subjects, following informed consent. Pulp under conditions supportive of marrow stromal was digested for 1 h at 37°C in a solution containing cells growth. This population, termed adipose 3 mg/ml type I collagenase, 4 mg/ml Dispase, in tissue‑derived stem cells (ADSCs), after expansion 4 ml phosphate‑buffered saline (PBS) supplemented in culture display a distinct phenotype based on cell with 100 U/ml penicillin, 100 µg/ml streptomycin surface protein expression and cytokine expression.[17] and 500 µg/ml clarithromycin. The solution was then filtered with 70 µm Falcon strainers (Sigma In this study we compared the expression profiling Aldrich, Inc., St Louis, Mo, USA). Filtered cells were of stem cells (DPSCs and ADSCs) cultivated on two cultivated in α‑MEM culture medium (Sigma Aldrich, type of surface: Pure titanium disk (TD) and nanotube Inc., St Louis, Mo, USA) supplemented with 20% titanium disk (NTD) in order to detect if NTD surface FCS, 100 µM 2P‑ascorbic acid, 2 mM L‑glutamine, stimulates MSCs towards osteoblast differentiation.
100 U/ml penicillin, 100 µg/ml streptomycin and The quantitative expression of the mRNA of specific placed in 75 ml flasks. Flasks were incubated at 37°C genes, like transcriptional factors (RUNX2 and SP7), and 5% CO and the medium changed twice a week.
bone‑related genes (SPP1, COL1A1, COL3A1, ALPL, ADSCs isolation
and FOSL1) and MSCs marker (ENG) were examined Human ADSCs were isolated from adipose tissue by means of real‑time Reverse Transcription‑Polymerase obtained by liposuction of adult volunteer patients. Chain Reaction (real‑time RT‑PCR).
Fat was finely minced with sterile scissors, put in a tube and digested in DMEM supplemented with MATERIALS AND METHODS
1 mg/ml of collagenase type II, in 37°C water bath Titanium nanotubes disks preparation
for 60 min, swirling occasionally.
Disks of commercially pure grade‑1 titanium (Titania, Once centrifugated at 3000 rpm for 5 min, the sample Italy) have been used as substrate for the nanotube was removed from centrifuge, shaken vigorously Dental Research Journal / Dec 2012 / Vol 9 / Issue 8 (Supplement Issue 2)
Pozio, et al.: Titanium disks and osteoblasts differentiation (to completely separate stromal cells from primary 5% CO at 37°C. Cells were collected for RNA adipocytes) and centrifugated again for 5 min. The extraction at 15 and 30 days.
oily supernatant (which includes primary adipocytes) RNA processing
was aspirated and discarded, while the stromal For cellular lysis, and subsequent reverse transcription fraction at the bottom was washed three times with of the RNA released in the solution, the TaqMan Gene 10 ml of PBSA 1X and centrifugated again for Expression Cells‑to‑Ct Kit (Ambion Inc., Austin, TX, 5 min. Finally the pellet was resuspended in 10 ml of USA) was used. Once cultured cells were lysed with Alpha MEM medium (Sigma Aldrich, Inc., St Louis, lysis buffer, free RNA was reverse transcribed to Mo, USA) supplemented with 10% fetal calf serum, cDNA using the RT Enzyme Mix and appropriate RT antibiotics (Penicillin 100 U/ml and Streptomycin buffer (Ambion Inc., Austin, TX, USA).
100 micrograms/ml‑Sigma, Chemical Co., St Louis, Mo, USA) and amino acids (L‑Glutamine ‑ Sigma, Finally the cDNA was amplified by real‑time Chemical Co., St Louis, Mo, USA). The medium was PCR using the included TaqMan Gene Expression replaced after 2‑3 days. Characterization of staminality Master Mix and the specific assay designed for the was carried out by flow cytometric analyses.
investigated genes.
Flow cytometric analyses
The purity of cell cultures was determined by Expression was quantified using real‑time PCR. After analysis of different antigens after staining with normalization to the expression of the housekeeping fluorochrome (FITC‑ or PE‑) conjugated mAbs gene RPL13A, the gene expression levels were anti‑human CD14‑FITC, CD14‑PE, CD34‑FITC, expressed as fold changes relative to the expression CD45‑FITC, CD90‑PE, CD105‑PE (Immunotech, of the untreated cells. Quantification was done with Marseille, France) and analyzed by FACScan. the delta/delta calculation method.[18] The nonspecific mouse IgG was used as isotype Specific forward and reverse primers and probes for control (Immunotech). To avoid nonspecific the selected genes were designed using primer express fluorescence from dead cells, live cells were gated software (Applied Biosystems, Foster City, CA, USA) tightly using forward and side scatter.
and are listed in Table 1.
Cell culture
All PCR reactions were performed in a final volume For the assay, ADSCs and DPSCs were trypsinized of 20 µl containing 10 µl 2X TaqMan Universal PCR upon sub‑confluence and seeded on NTD and TD.
master mix (Applied Biosystems, Foster City, CA, The medium was changed every 3 days. The cells USA), 400 nM concentration of each primer and were maintained in a humidified atmosphere of 200 nM of the probe, and cDNA. The amplifications Table 1: Primer and probes used in real‑time Polymerase chain reaction
Gene symbol Gene name
Collagen type I alpha1 Runt‑related transcription factor 2 F‑TCTACCACCCCGCTGTCTTC Alkaline phosphatase Collagen, type III, alpha 1 FOS‑like antigen 1 Ribosomal protein L13 Dental Research Journal / Dec 2012 / Vol 9 / Issue 8 (Supplement Issue 2) Pozio, et al.: Titanium disks and osteoblasts differentiation were carried out using the ABI PRISM 7500 (Applied ALPL and SPP1 were up‑regulated, while SP7, ENG Biosystems, Foster City, CA, USA). After an initial and RUNX2 were down‑regulated [Figure 1b].
denaturing step at 95°C for 10 min, amplification Gene expression profiling in DPSCs
profile proceeded with two‑step of 15 s at 95°C and Different results were obtained for DPSCs. After 60 s at 60°C for 40 cycles. All experiments were 15 days, stem cells cultivated on NTD showed performed including non‑template controls to check the up‑regulation of FOSL1 and SPP1 and the for the presence of contamination.
down‑regulation of SP7, ENG, RUNX2, COL3A1, COL1A1 and ALPL [Figure 2a].
After 30 days, the bone‑related genes ENG, FOSL1, ADSCs and DPSCs were cultivated on two type of RUNX2, COL3A1 and SPP1 were up‑regulated in surface NTD and TD. Gene expression in stem cells DPSCs cultivated on NTD, while ENG, FOSL1 and cultivated on NTD were compared with that cultivated ALPL were decreased [Figure 2b].
on TD (control) in order to check whether NTD is more osteoinductive with respect to TD.
Gene expression profiling in ADSCs
Titanium proved to be a good material for surgical After 15 days, ADSCs cultivated on NTD showed the application. Since thirty years it has been used to up‑regulation of bone‑related genes FOSL1, RUNX2, produce prosthesis for joint replacement and for dental COL1A1, ENG and the down‑regulation of SP7, ALPL substitution. Recently, titania film have been used and SPP1. Expression of COL3A1 was the same in to cover prosthetic implants in medical applications both cells (cultivated on NTD and TD) [Figure 1a].
such as orthopedic or dental surgery.[19] In prosthesis The results of real‑time PCR showed that in ADSCs made of titanium, the titania film surface is mainly cultivated on NTD after 30 days of treatment, the composed by two polymorphs of titanium, rutile and bone‑related genes FOSL1, COL3A1, COL1A1, anatase. Anatase titania is more advantageous for medical applications than rutile.
Figure 1: Relative gene expression of ADSCs cultivated on
Figure 2: Relative gene expression of DPSCs cultivated on
titanium disks for 15 days (a) and 30 days (b) titanium disks for 15 days (a) and 30 days (b) Dental Research Journal / Dec 2012 / Vol 9 / Issue 8 (Supplement Issue 2)
Pozio, et al.: Titanium disks and osteoblasts differentiation In this study, we tested the osteoinductive property Osteo‑differentiation promoted by NTD was observed of TDs covered with nanotube in order to detect in DPSCs too, after 15 and 30 days of treatment.
if this surface is better than pure TDs in terms of After 15 days, the up‑regulation of the bone‑related osseointegration. Osseointegration is primary element genes FOSL1 and SPP1 was observed.
to value when considering implant stability.[20‑22] Their up‑regulation continued in the next 30 days To study the osteoinductive properties of NTD, of treatment, associated to an increasing of two the expression levels of bone‑related genes were osteoblasts‑related genes, RUNX2 and COL3A1.
measured using real‑time RT‑PCR in mesenchymal stem cells cultivated on TD.
The study was first conducted in ADSCs. The gene expression levels were measured at two time point: These results demonstrated that NTD surface is more 15 and 30 days.
osteo‑induced surface compared to TD, promoting the differentiation of mesenchymal stem cells in The up‑regulation of the bone‑related genes RUNX2, osteoblasts.
COL1A1 and FOSL1 in the first 15 days of cells culture indicated that NTD enhance osteo‑differentiation and REFERENCES
proliferation compared to TD.
RUNX2 is an important modulator of osteoblast 1. Carinci F, Guidi R, Franco M, Viscioni A, Rigo L, De Santis B, et al. Implants inserted in fresh‑frozen bone: A retrospective differentiation that is activated in the first stage analysis of 88 implants loaded 4 months after insertion. of differentiation and plays a fundamental role in Quintessence Int 2009;40:413‑9.
osteoblast maturation and homeostasis. RUNX2‑null 2. Fanali S, Carinci F, Zollino I, Brugnati C, Lauritano D. One‑piece mice have no osteoblasts and consequently bone implants installed in restored mandible: a retrospective study. tissue.[23] Thus we demonstrated that NTD increase Eur J Inflamm 2012;10:37‑41.
the activity of RUNX2 gene in ADSCs, which is a 3. Fanali S, Carinci F, Zollino I, Brugnati C, Lauritano D. key point in osteo‑differentiation.
A retrospective study on 83 one‑piece implants instal ed in resorbed maxilla. Eur J Inflamm 2012;10:55‑8.
FOSL1 encodes for Fra‑1, a component of the dimeric 4. Fanali S, Carinci F, Zollino I, Brunelli G, Minguzzi R. Effect of transcription factor activator protein‑1 (AP‑1). AP‑1 distance between one piece implants on crestal bone resorption. sites are present in the promoters of many osteoblast Eur J Inflamm 2011;9:1‑6.
5. Fanali S, Carinci F, Zollino I, Brunelli G, Minguzzi R. Effect of genes, including alkaline phosphatase, collagen I and one‑piece implant diameter on clinical outcome. Eur J Inflamm Type I collagen synthesis is associated with osteoblast 6. Fanali S, Carinci F, Zollino I, Brunelli G, Minguzzi R. Impact of one‑piece implant lenght on clinical outcome. Eur J Inflamm differentiation in the early stage, followed by the synthesis of ALP.[24] 7. Fanali S, Carinci F, Zollino I, Brunelli G, Minguzzi R. Welding In fact ALPL was up‑regulated after 30 days in stem improbe the success rate of one‑piece implants. Eur J Inflamm cells cultivated on NTD. Increasing in ALPL expression 8. Fanali S, Carinci F, Zollino I, Brunelli G, Minguzzi R. Bio‑grip is associated with osteoblast differentiation.[25] and machined titanium stimulate dental pulp stem cells towords After 30 days SPP1 and collagens were up‑regulated osteoblast differentiation. Eur J Inflamm 2011;9:25‑30.
9. Gapski R, Wang HL, Mascarenhas P, Lang NP. Critical review of immediate implant loading. Clin Oral Implants Res SPP1 encodes osteopontin, which is a phosphoglycoprotein of bone matrix and it is the 10. Li LH, Kong YM, Kim HW, Kim YW, Kim HE, Heo SJ, most representative non‑collagenic component of et al. Improved biological performance of Ti implants due to surface modification by micro‑arc oxidation. Biomaterials extracellular bone matrix.[26] The present study demonstrated that NTD strongly 11. Reinholt FP, Hultenby K, Oldberg A, Heinegard D. Osteopontin‑‑a influences the behavior of ADSCs in vitro by possible anchor of osteoclasts to bone. Proc Natl Acad Sci U S A enhancing proliferation, differentiation and deposition 12. Chan TF, Poon A, Basu A, Addleman NR, Chen J, Phong A, of matrix as demonstrated by the activation of et al. Natural variation in four human collagen genes across an osteoblast‑related genes RUNX2, COL1A1 and SPP1.
ethnically diverse population. Genomics 2008;91:307‑14.
Dental Research Journal / Dec 2012 / Vol 9 / Issue 8 (Supplement Issue 2) Pozio, et al.: Titanium disks and osteoblasts differentiation 13. Mitsiadis TA, Barrandon O, Rochat A, Barrandon Y, De Bari C. from man. Eur J Inflamm 2012;10:7‑12.
Stem cell niches in mammals. Exp Cell Res 2007;313:3377‑85.
22. Scarano A, Murmura G, Carinci F, Lauritano D. Immediately 14. Laino G, d'Aquino R, Graziano A, Lanza V, Carinci F, Naro F, loaded small diameter dental implants: Evaluation of retention, et al. A new population of human adult dental pulp stem cells: stability and comfort for the edentulous patient. Eur J Inflamm A useful source of living autologous fibrous bone tissue (LAB). J Bone Miner Res 2005;20:1394‑402.
23. Ziros PG, Basdra EK, Papavassiliou AG. Run×2: Of bone and 15. Laino G, Graziano A, d'Aquino R, Pirozzi G, Lanza V, Valiante S, stretch. Int J Biochem Cell Biol 2008;40:1659‑63.
et al. An approachable human adult stem cell source for 24. Harris SE, Bonewald LF, Harris MA, Sabatini M, Dallas S, hard‑tissue engineering. J Cell Physiol 2006;206:693‑701.
Feng JQ, et al. Effects of transforming growth factor beta on 16. Zuk PA, Zhu M, Ashjian P, De Ugarte DA, Huang JI, Mizuno H, bone nodule formation and expression of bone morphogenetic et al. Human adipose tissue is a source of multipotent stem cells. protein 2, osteocalcin, osteopontin, alkaline phosphatase, and Mol Biol Cell 2002;13:4279‑95.
type I collagen mRNA in long‑term cultures of fetal rat calvarial 17. Gronthos S, Franklin DM, Leddy HA, Robey PG, Storms RW, osteoblasts. J Bone Miner Res 1994;9:855‑63.
Gimble JM. Surface protein characterization of human adipose 25. Turksen K, Bhargava U, Moe HK, Aubin JE. Isolation of tissue‑derived stromal cells. J Cell Physiol 2001;189:54‑63.
monoclonal antibodies recognizing rat bone‑associated molecules 18. Livak KJ, Schmittgen TD. Analysis of relative gene expression in vitro and in vivo. J Histochem Cytochem 1992;40:1339‑52.
data using real‑time quantitative PCR and the 2(‑Delta Delta C (T)) 26. McKee MD, Farach‑Carson MC, Butler WT, Hauschka PV, Method. Methods 2001;25:402‑8.
Nanci A. Ultrastructural immunolocalization of noncollagenous 19. Moritz N, Areva S, Wolke J, Peltola T. TF‑XRD examination of (osteopontin and osteocalcin) and plasma (albumin and alpha surface‑reactive TiO2 coatings produced by heat treatment and 2HS‑glycoprotein) proteins in rat bone. J Bone Miner Res CO laser treatment. Biomaterials 2005;26:4460‑7.
20. Brunelli G, Carinci F, Zollino I, Candotto V, Scarano A, Lauritano D. Peri‑Implantitis: A case report and literature review. How to cite this article: Pozio A, Palmieri A, Girardi A, Cura F,
Eur J Inflamm 2012;10:1‑6.
Carinci F. Titanium nanotubes stimulate osteoblast differentiation of 21. Brunelli G, Carinci F, Zollino I, Candotto V, Scarano A, stem cells from pulp and adipose tissue. Dent Res J 2012;9:S169‑74.
Lauritano D. SEM evaluation of 10 infected implants retrived Source of Support: Nil. Conflict of Interest: None declared.
Dental Research Journal / Dec 2012 / Vol 9 / Issue 8 (Supplement Issue 2)

Source: http://home.teletu.it/Potio/works/1343-3569-2-PB.pdf