Joelkostka.net

APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Oct. 2001, p. 4566–4572 Copyright 2001, American Society for Microbiology. All Rights Reserved.
Growth and Phylogenetic Properties of Novel Bacteria Belonging to the Epsilon Subdivision of the Proteobacteria Enriched from Alvinella pompejana and Deep-Sea Hydrothermal Vents BARBARA J. CAMPBELL,1 CHRISTIAN JEANTHON,2 JOEL E. KOSTKA,3 GEORGE W. LUTHER III,1 AND S. CRAIG CARY1* College of Marine Studies, University of Delaware, Lewes, Delaware 199581; UMR6539, Centre National de la Recherche Scientifique and Universite´ de Bretagne Occidentale, 29280 Plouzane´, France2; and Department of Oceanography, Florida State University, Tallahassee, Florida 323063 Received 20 March 2001/Accepted 4 July 2001 Recent molecular characterizations of microbial communities from deep-sea hydrothermal sites indicate the
predominance of bacteria belonging to the epsilon subdivision of Proteobacteria (epsilon Proteobacteria). Here,
we report the first enrichments and characterizations of four epsilon Proteobacteria that are directly associated
with Alvinella pompejana, a deep sea hydrothermal vent polychete, or with hydrothermal vent chimney samples.
These novel bacteria were moderately thermophilic sulfur-reducing heterotrophs growing on formate as the
energy and carbon source. In addition, two of them (Am-H and Ex-18.2) could grow on sulfur lithoautro-
trophically using hydrogen as the electron donor. Optimal growth temperatures of the bacteria ranged from 41
to 45°C. Phylogenetic analysis of the small-subunit ribosomal gene of the two heterotrophic bacteria demon-
strated 95% similarity to Sulfurospirillum arcachonense, an epsilon Proteobacteria isolated from an oxidized
marine surface sediment. The autotrophic bacteria grouped within a deeply branching clade of the epsilon Pro-
teobacteria, to date composed only of uncultured bacteria detected in a sample from a hydrothermal vent along
the mid-Atlantic ridge. A molecular survey of various hydrothermal vent environments demonstrated the pres-
ence of two of these bacteria (Am-N and Am-H) in more than one geographic location and habitat. These re-
sults suggest that certain epsilon Proteobacteria likely fill important niches in the environmental habitats of
deep-sea hydrothermal vents, where they contribute to overall carbon and sulfur cycling at moderate thermo-
Several recent molecular studies have demonstrated the report that suggests that an epsilon Proteobacteria belonging to presence and dominance of bacteria belonging to the epsilon the Arcobacter group is involved in filamentous sulfur produc- subdivision of Proteobacteria (epsilon Proteobacteria) that are tion at hydrothermal vents, although it has not been isolated or both free-living and found in association with metazoans at phylogenetically characterized (44). Similar filamentous pro- deep-sea hydrothermal vents (4, 5, 14, 25, 29, 35; Campbell et duction of sulfur occurred in continuous-flow H2S reactors al., unpublished data). Epsilon Proteobacteria have also been with an Arcobacter sp. isolated from shallow coastal marine detected and/or isolated from deep subsurface sediments, oil waters (43).
fields, activated sludge, and marine snow (13, 20, 34, 40, 45).
Our laboratory has been investigating the symbiotic relation- Until now, however, epsilon Proteobacteria have not been cul- ship between Alvinella pompejana, a deep-sea hydrothermal tured from hydrothermal vent environments. All epsilon Pro- vent polychete, and the morphologically and phylogenetically teobacteria isolated to date are involved in the sulfur cycle by diverse episymbiont community that is integrated into its dor- either reducing elemental sulfur to sulfide or oxidizing sulfide sal epithelium (4, 5, 7, 14). We have demonstrated through a to sulfur. In many cases, a single bacterium is able to do both variety of molecular techniques that members of a single clade (24, 37). A hallmark of the epsilon Proteobacteria is their ability of the epsilon Proteobacteria dominate the microbial commu- to utilize a variety of electron acceptors, including oxygen nity (4, 5, 14). Several attempts have been made in the past to (under microaerophilic conditions), nitrate, several sulfur spe- isolate A. pompejana epibionts under mesophilic, aerobic, and cies, and, in some cases, arsenate, selenate, manganese, and heterotrophic conditions (16, 31–33). In a recent study, we Fe(III) (12, 18, 27, 28, 42). Because of these capabilities, it is confirmed that these attempts did not isolate any epsilon Pro- not surprising that they flourish at hydrothermal vents, where teobacteria and that members of the A. pompejana episymbiont there are high levels of many sulfur species as well as an community identified previously by molecular studies (14) are abundance of heavy metals (10, 17, 22, 23, 36).
not present in these extensive culture collections (Campbell et Although inferences can be drawn about the biochemistry of al., unpublished data).
hydrothermal vent epsilon Proteobacteria, little is actually The goal in this study was to isolate epsilon Proteobacteria known about the chemical and thermal conditions needed for from the dorsal epithelium of A. pompejana by enrichment the growth of this dominant bacterial group. There is one culture techniques. Positive enrichments would likely further our understanding of the biochemical conditions necessary for both epibiont and free-living bacterial growth. In addition, we * Corresponding author. Mailing address: College of Marine Stud- ies, University of Delaware, Lewes, DE 19958. Phone: (302) 645-4078.
extended our epsilon Proteobacteria isolation attempts to sul- Fax: (302) 645-4007, E-mail: [email protected].
fidic chimney samples from hydrothermal vents at 13°N lati- NOVEL HYDROTHERMAL VENT ε PROTEOBACTERIA TABLE 1. Details of samples used for enrichments and PCR analysis Vent (latitude, longitude) Grandbonum (12°48⬘7⬙N, 103°56⬘4⬙W) PP55 (12°49⬘84⬙N⬘, 103°56⬘8⬙W) PP57 (12°50⬘32⬙N, 103°56⬘80⬙W) PPHot14 (12°48⬘18⬙N, 103°56⬘39⬙W) Grandbonum (12°48⬘7⬙N, 103°56⬘4⬙W) PPHot14 (12°48⬘18⬙N, 103°56⬘39⬙W) PP57 (12°50⬘32⬙N, 103°56⬘80⬙W) Q vent (9°50⬘727⬙N, 104°17⬘58⬙W) M vent (9°50⬘83⬙N, 104°17⬘58⬙W) K2 (27°00⬘84⬙N, 111°24⬘48⬙W) Robin's Roost (27°00⬘88⬙N, 111°24⬘63⬙W) Robin's Roost (27°00⬘88⬙N, 111°24⬘63⬙W) K2 (27°00⬘84⬙N, 111°24⬘48⬙W) Kristin's Summit (27°00⬘83⬙N, 111°24⬘68⬙W) Rebecca's Roost (27°00⬘66⬙N, 111°24⬘42⬙W) a Growth with acetate, pyruvate, formate, and sulfur at 50°C for the 13°N samples and acetate, formate and sulfur at 45°C for the Guaymas samples. Based on morphologic and identical migrations on DGGE. ND, not done.
tude along the East Pacific Rise (EPR) and at the Guaymas Positive enrichments were subcultured five times on board ship and/or in the basin. A molecular survey of various hydrothermal vent sites laboratory until stable cultures (cultures that did not change, based on micro- was also performed to investigate the ecology of two novel scopic or molecular analysis) were obtained. These subcultures were consideredpure when microscopic and molecular evidence indicated only one type of bac- epsilon Proteobacteria that were enriched from the 13°N A. terium per culture. DNA was extracted from all the positive enrichments and pomejana epibiont community.
stable cultures and subjected to DNA fingerprinting analysis (denaturing gradi-ent gel electrophoresis [DGGE]) as described previously (4, 38). Universal prim-ers for both bacteria and archaea were used in the DGGE analysis to assess the MATERIALS AND METHODS
purity of the cultures. In addition purity of the cultures was assessed by micro- Sampling and enrichment conditions. Initial enrichments were from A. pom-
scopic analysis.
pejana worms sampled from various hydrothermal vents along the EPR during Growth characterizations. Two of the epsilon Proteobacteria cultures that were
the Amistad cruise, May to June 1999, to 13°N (12°49⬘N, 103°56⬘W) at a depth considered pure (Am-H and Am-N) were subjected to limited physiological of approximately 2,500 m (Table 1). A. pompejana specimens (in their associated assessment. Initial cultures were grown in the sulfur medium described above tubes) were collected and transported to the surface via the deep-submergence with the addition of formate and acetate as potential electron donor and carbon vehicle (DSV) Nautile in an enclosed container. Once on board, A. pompejana worms were removed from their tubes and associated chimneys, and washed The temperature range tested was from 30 to 65°C. Other carbon sources three times in sterile 0.22-␮m-filtered seawater, and the epibiont community (CO2, pyruvate [20 mM], fumarate [0.2%], 0.2% peptone, formate [10 mM], and (found mainly on the hair-like projections) were scraped into a sterile 50-ml tube.
acetate [10 mM]), electron donors (H2 and formate), and electron acceptors The hairs were slightly homogenized with a 20-gauges needle in a final volume of [sulfite (5 mM), thiosulfate (10 mM), and Fe(III)] were evaluated. In addition, 10 ml containing sterile seawater and aseptically transferred to anaerobic me- growth with various gas mixtures (H2-CO2, 90:10, 150 kPa, and N2, 100%, 150 dium (described below). A portion of the homogenate was saved for DNA kPa) was tested. Growth using Fe(III)-oxyhydroxide was evaluated on media extraction and preservation in glycerol at ⫺80°C.
prepared and manipulated as above (47).
For the enrichments from chimney samples, sulfides were collected from the We modified the medium for Fe reducers by adding 2 mM ferrous chloride as Guaymas basin, a sediment- and hydrocarbon-rich hydrothermal site in the Gulf a reductant in place of dissolved sulfide. Amorphous Fe(III)-oxyhydroxide was of California (27°00⬘N, 111°24⬘W) at a depth of approximately 2,000 m, during added to the autoclaved medium as the sole electron acceptor to a final concen- the Extreme 2000 cruise, January 2000 (Table 1). The outsides of chimneys were tration of 50 mM. The Fe(III) oxide was prepared by neutralizing a solution of scraped aseptically into sterile tubes, and anaerobic sterile seawater was added FeCl3, rinsing, and autoclaving as described previously (21). All medium prep- (10⫻, vol/vol).
aration and manipulations were carried out under strictly anoxic conditions Approximately 1 ml of diluted sample (hairs or chimney) was used for each unless otherwise specified. Sterile medium components for the Fe(III) medium were combined, and the medium was dispensed into serum bottles which were Medium used for enrichments was modified from that of Widdel and Bak (47) sealed with butyl rubber stoppers under a gas stream of 90% N2 and 10% CO2 and contained (per liter): 20 g of NaCl, 3 g of MgCl (100 kPa). Inocula for all the metabolic characterizations were 1/20th volume.
2 䡠 6H2O, 0.15 g of CaCl2 䡠 Positive cultures were subcultured an additional time to confirm growth in the 2O, 0.5 g of KCl, 0.25 g of NH4Cl, 0.2 g of KH2PO4, 1 ml of trace element solution (46), 1 ml of selenite-tungstate solution, 0.015 g of resazurin, 30 ml of tested medium (and not growth from the original inoculum). Negative cultures were tested from the source inoculum at least twice. Additional negative controls 3, 1 ml of vitamin mixture solution, 1 ml of vitamin B12 solution, 1 ml of thiamine solution, and 5 ml of 0.2 M Na included growth with no added substrates (other than the basal minimal medium 2S as a reductant (47). Elemental sulfur (approximately 5 g/liter) was sterilized by heating to 100°C three times and with and without added sulfur). Cells were counted after 3 days by epifluorescent added aseptically after the medium was autoclaved. The final pH was adjusted to microscopy after fixation with 3.7% formaldehyde, staining with DAPI (4⬘,6⬘- approximately 7.0, and the headspace consisted of N2-CO2 (80:20; 150 kPa).
diamidino-2-phenylindole) (2 ␮g/ml), and filtration onto a 0.22-␮m polycarbon- A combination of three potential electron donors and carbon sources (formate ate filter (30). Growth was scored as positive if there was a greater than fivefold [20 mM final concentration], acetate [2 mM final concentration], and pyruvate increase in cells compared to control tubes with no added substrates.
[20 mM final concentration]) was added separately from sterile, anoxic stocks to Growth curves of the stable subcultures were performed four times at their individual tubes before inoculation for the 13°N enrichments. Enrichments from optimal temperatures in minimal enrichment medium with added sulfur and the chimneys collected at Guaymas basin were performed in the sulfur medium formate (20 mM) under an N2-CO2 gas headspace. Growth was also measured in with added formate and acetate. The A. pompejana enrichments were incubated sulfur medium without formate. Cells were counted by epifluorescent microscopy at 30, 50, and 65°C, while the chimney enrichments were incubated at 45 and as described above.
60°C. Growth was monitored microscopically.
Hydrogen sulfide production was measured using the Cline method (6). Light CAMPBELL ET AL.
APPL. ENVIRON. MICROBIOL.
photomicrographs were obtained after staining with DAPI (2 ␮g/ml) as de- TABLE 2. Characteristics of Am-N and Am-H enriched scribed above. The lengths and widths of the bacteria were measured on an from A. pompejana episymbiont biomass Olympus Provis AX70 microscope using a 100⫻ objective with a Chroma 31000band pass filter set. Lengths and widths of the bacteria were estimated from a frequency plot of the values for approximately 100 individual bacteria.
Slightly curved rods Phylogenetic assessment. The 16S ribosomal DNAs (rDNAs) of the bacteria
were amplified from extracted DNA using the 21F and 1518R primers as de- scribed previously (14) and cloned into a Topo-TA vector (Invitrogen, Carlsbad, Calif.) according to the manufacturer's instructions. The resulting 16S rDNA clones were bidirectionally sequenced on an ABI 310 sequencer (Applied Bio- Temp optimum (°C) systems, Inc. [ABI], Foster City, Calif.) using the TA vector-specific primers Growtha on carbon source M13F and M13R (Invitrogen) as well as 519F, 519R, 1100F, and 1100R (1).
(in presence of S0) DNA sequences were assembled using the ABI Autoassembler program (ABI) and aligned to other 16S rDNA sequences using Genetic Data Environment (GDE) (39) as described previously (14). DNA distance similarities were deter- mined by the method of Olsen (26). Neighbor-joining and parsimony trees were Autotrophic growth (with H2 in obtained in GDE as previously described (14).
Presence of bacteria in the environment. DNA was extracted from the A.
Electron donor (with S0) pompejana epibiont samples listed in Table 1 using an Isoquick DNA extraction kit (ORCA Research, Bothwell, Wash.) as described previously (4). Several DNA extraction protocols were used on various chimney-flange samples (Table 1) to evaluate extraction efficiencies and potential PCR inhibition effects.
DNA was initially extracted from approximately 500 ␮l of ground chimney samples (slurries) from 9°N and 13°N with acetyltrimethylammonium bromide– Pyruvate, peptone polyvinylpyrrolidone–␤-mercaptoethanol (CTAB/PVP/␤-ME) method as de- scribed previously (8) and resuspended in 50 ␮l of sterile H2O. We found better Thiosulfate, sulfite yields and less inhibition when extracting from an equal amount of chimney slurry with the QIAamp DNA stool mini kit (Qiagen, Valencia, Calif.). DNA wasextracted from the Guaymas chimney-flange samples using this kit and resus- a As measured by turbidity, microscopic counts, and H2S production.
pended in 50 ␮l of sterile H Positive growth on sulfur granules only (microscopic evaluation and H 2O. From 1 to 10 ng of DNA was used in PCR for DGGE analysis as described previously (4, 38). The universal forward primer production; cultures were not turbid).
c In the presence of formate and acetate.
338F (with a GC clamp) was also used in combination with two strain-specific16S rDNA primers (for Am-H, H607R [5⬘- CTCCCGAACTCTAGTCTGA],and for Am-N, N601R [5⬘- CTAGATAAACAGTTTCAAGA], based on Esch- cultures in the same medium as above, it was also confirmed to erichia coli numbering [3]) in PCR amplifications for DGGE to determine the be a single bacterium by both microscopy and DGGE analysis presence of strain Am-H or Am-N in the indicated samples.
(data not shown). Compared to the first bacterium, it grew fast- Nucleotide sequence accession numbers. The 16S rDNA sequences for Am-H,
Am-N, Ex-18.1, and Ex-18.2 were deposited in GenBank and assigned accession er at 50°C, was smaller in size, and was also motile (Table 2).
numbers AF357197, AF357198, AF357199, and AF357196, respectively.
Two other epsilon Proteobacteria, designated Ex-18.1 and Ex-18.2, were enriched from several chimney samples collected from hydrothermal vents in the Guaymas basin using similar conditions as above, except the initial incubation temperature Enrichments. Enrichments from A. pompejana samples col-
was reduced to 45°C and the sulfur medium contained only lected from 13°N that were grown at 30°C yielded bacteria that formate and acetate. The first bacterium, Ex-18.1, was mor- varied widely in their morphologies, while little to no growth phologically and phylogenetically similar to Am-N. Morpho- occurred at 65°C. Successful enrichments of two morphologi- logic and DGGE analysis of enrichments from K2 and Robin's cally different populations of bacteria that were grown at 50°C Roost indicated that bacteria identical to Ex-18.1 were also were obtained from A. pompejana samples collected from two found at these vent sites (Table 1 and data not shown). The separate hydrothermal vent sites (Table 1). Initially, both en- types of samples used in the enrichments were somewhat dif- richments contained a dominant bacterial morphotype, with ferent; the sample from K2 was a flange outcropping, while the several minor morphotypes. After subculturing, only the dom- sample from Robin's Roost was a sulfidic chimney. The second inant bacterium in each enrichment was detected by DGGE chimney bacterium, Ex-18.2, was enriched from three other and microscopy. The first bacterial morphotype recovered samples collected from Guaymas: Robin's Roost flange, an- from three separate A. pompejana specimens (A, N, and X) other K2 flange, and a flange collected from Kristin's Summit grew on acetate-formate-sulfur medium (Table 1). These cul- (Table 1 and data not shown). According to morphologic and tures consisted of slow-growing (doubling time, ⬎24 h at 50°C) DGGE analysis, it was morphologically and phylogenetically motile vibrioid cells (Table 2). Stable subcultures of the dom- similar to Am-H.
inant morphotypes were obtained after decreasing the incuba- Preliminary characterization of bacteria and growth rates.
tion temperature to 45°C. DGGE analysis of the three subcul- Two of the isolates, Am-H and Am-N, were chosen for further tures demonstrated three identically migrating bands that were characterization. Am-H and Am-N are slightly curved rods indistinguishable by sequence analysis of 110 bp (data not with widths of 0.3 and 0.3 ␮m and lengths of 0.4 and 0.8 ␮m, shown). These strains were considered similar. Therefore, a respectively (Table 2). Am-H is highly motile, while Am-N is subculture from the N enrichment was chosen to be charac- less motile. As shown in Table 2, the temperature growth terized; it was designated Am-N.
ranges of these organisms varied slightly; Am-H generally grew The second bacterial morphotype (Am-H) was enriched at higher temperatures (up to 55°C but not above) and had a from a single A. pompejana specimen collected from PP55, also higher temperature optimum (45°C) than Am-N (50 and 41°C, located along the EPR at 13°N (Table 1). After several sub- respectively). Growth curves for the two bacteria were per- NOVEL HYDROTHERMAL VENT ε PROTEOBACTERIA Phylogenetic affiliations. According to their 16S rDNA se-
quences, Am-N and Am-H and their close relatives from the Guaymas basin (Ex-18.1 and Ex-18.2) grouped into the epsilon subdivision of the Proteobacteria (Fig. 2). Am-N showed 99.2% identity with Ex-18.1 and 96.5 and 94.5% identity with Sulfu- rospirillum arcachonense and Sulfurospirillum barnesii, respec- tively, by DNA distance analysis. Am-H and Ex-18.2 (Fig. 2) were much more distantly related to the Sulfurospirillum, grouping into a previously described deeply branching epsilon clade that contains uncultured 16S rDNA clones from a hy- drothermal vent cap deployed at the Snake Pit vent along the mid-Atlantic ridge (35). Am-H was 99% identical to Ex-18.2 and showed 95.4 and 87.5% identity to VC2.1 Bac43 and VC2.1 Bac30, respectively.
Ecological significance of isolates. Nine A. pompejana sam-
ples and nine chimney or flange samples (samples designated by letters and numbers in Table 1) were tested by PCR with strain-specific primers, followed by DGGE analysis for the presence of bacteria with migration patterns identical to those of either Am-N or Am-H (Fig. 3). Positive PCRs which mi- grated identically to Am-N on a DGGE gel were obtained from all A. pompejana specimens tested from the 13°N latitude with the primer designed to specifically amplify Am-N (repre- sentative amplifications are shown in Fig. 3A). Bands migrat- ing identically to Am-N were also amplified from DNA ex- tracted from two chimney samples, one from 13°N (M chim.) and one from 9°N (97 chim.). No positive PCRs were obtained with the Am-N-specific primer with DNA extracted from one chimney sample from 9°N (215 chim.) or from any of the samples collected from the Guaymas basin. Similar results FIG. 1. Representative growth curves of strains Am-H (A, }) and were obtained with an Am-H-specific primer. However, two A. Am-N (B, ■). Cell densities (solid lines) and hydrogen sulfide produc- tion (dashed lines) were measured with formate as the electron donor pompejana specimens were negative (Am-G and Am-N), while and elemental sulfur as the electron acceptor at their individual tem- all the chimney samples from 9°N and 13°N were positive (Fig.
perature optimums under anaerobic conditions (N2-CO2 gas phase).
3B). Very weak amplification products were obtained with an Controls were inoculated tubes without added formate (F).
Am-H-specific primer on two samples collected from the Guaymas basin, and three others were negative.
The A. pompejana worms and the three chimney samples formed at least four separate times in a basal minimal medium from 9°N and 13°N were also tested for the presence of the with added elemental sulfur and formate. Representative isolates Am-H and Am-N by DGGE analysis with universal primers to detect all bacteria present in the samples (Fig. 4).
curves are illustrated in Fig. 1. Am-N had a slightly longer The A. pompejana bacterial communities from 13°N contained doubling time than Am-H (9 h versus 6 h, respectively), as very similar members, as indicated by the number of identically calculated by the slope of the growth curves during the linear migrating bands. However, no bands corresponding to Am-H phase of growth (Fig. 1). Based on the graphic comparison of or Am-N were observed on the gel, suggesting that these bac- the number of cells per mole of H2S produced, growth yields of teria were minor members of the communities tested. This was Am-H were approximately twice that of Am-N (data not also the case for two of the chimney samples (M and 97).
Chimney 215 did have observable bands migrating similarly to Growth of Am-N and Am-H was tested with a limited series PCR amplicons from the bacterial cultures Am-H and Am-N of gas mixtures, electron acceptors, and carbon sources (Table (indicated by the arrows in Fig. 4). After sequencing these 2). Both Am-N and Am-H grew heterotrophically using for- highly visible bands, it was determined that they were not mate as a carbon source and sulfur as the electron acceptor.
identical to either Am-H or Am-N, confirming the previous They were not able to use thiosulfate, sulfite, and Fe(III)- negative PCR results with the Am-N-specific primers on the oxyhydroxide as alternative electron acceptors in the presence sample from chimney 215.
of formate. None used acetate as an energy and carbon source.
With sulfur, Am-H was able to grow lithoautotrophcally using hydrogen and formate as electron donors and heterotrophi-cally in the presence of pyruvate. Fermentation of fumarate This is the first report of the isolation of Proteobacteria belong- was performed by Am-N. The ability of Am-N and Am-H to ing to the epsilon subdivision from deep-sea hydrothermal vents.
grow under low levels of oxygen and with nitrate as electron Our and previous PCR-based experiments demonstrated that in acceptors was not tested.
hydrothermal vent environments, epsilon Proteobacteria dominate CAMPBELL ET AL.
APPL. ENVIRON. MICROBIOL.
FIG. 2. Phylogenetic tree showing the relationships between isolated strains with other members of the epsilon subdivision of the Proteobacteria.
The trees are based on alignments of approximately 1,500 bp from the 16S rDNA gene minus insertions, deletions, and ambiguous bases. E. coli was used as the outgroup. Bootstrap values from 100 resamplings are indicated prior to the branch points of the tree. Sequences from the isolates are marked in boldface type. The scale bar represents the calculated number of changes per nucleotide position.
the free-living organisms on the outer surfaces of chimneys and/or not unique to the Proteobacteria, but has only been described are closely associated with invertebrate hosts (4, 5, 14, 25, 29).
in one other previously identified epsilon Proteobacteria (an Large percentages of diverse epsilon Proteobacteria have also Arcobacter sp.) isolated from oil field brine (13). Until this been detected from a vent cap deployment along the mid-Atlantic report, all anaerobic elemental sulfur-reducing chemolithoau- ridge (35). These reports suggest that the epsilon subdivision of totrophic bacteria described from hydrothermal vents were Proteobacteria plays a major role in the bacterial communities at thermophiles and hyperthermophiles (2, 19, 41). Many sulfur- hydrothermal vents. One of the strains described here (Am-H) oxidizing chemolithoautotrophs have been described from ma- has some properties similar to other cultured epsilon Proteobac- rine environments, including hydrothermal vents, but these teria, such as growth with fumarate. However, both strains are microorganisms oxidize sulfides in the presence of O2 (9, 15).
novel in that they grow at moderate thermophilic temperatures.
Alternate chemolithoautotrophic metabolisms involving the While we have no direct evidence for carbon fixation by Am-H, disproportionation of elemental sulfur have been described in the deeply branching epsilon Proteobacteria are able to au- marine environments (11), but have not been described from totrophically use elemental sulfur, hydrogen, and CO2 for growth bacteria isolated at deep-sea hydrothermal vents or by epsilon under anaerobic conditions.
Proteobacteria. It seems likely that the deeply branching epsi- Autotrophy involving the reduction of elemental sulfur is lon Proteobacteria described here (Am-H), and possibly other

NOVEL HYDROTHERMAL VENT ε PROTEOBACTERIA The epsilon Proteobacteria described in this paper were en- riched from both A. pompejana samples and geographically dis- tinct chimney samples from deep-sea hydrothermal vents from 13°N and the Guaymas basin. Because of the presumed and measured chemical differences in the samples from the sediment- starved EPR and the hydrocarbon and sediment-rich Guaymas basin (10, 22, 23; Luther et al., unpublished data), we were ini- tially surprised by our ability to enrich for such phylogenetically similar bacteria (99%) from these two areas. We therefore believe that the physiological abilities of the cultured epsilon Proteobac- teria reported in this paper are possibly far more diverse than we have described. The molecular survey that demonstrated these isolates at geographically and chemically distinct hydrothermal vent sites (9°N, 13°N, and the Guaymas basin) supports the FIG. 3. DGGE of positive PCR products obtained after amplifica- hypothesis that these epsilon Proteobacteria potentially have tion using strain-specific primers for Am-N (A) and Am-H (B). Lanes wide physiological abilities.
1 to 8, separated amplification products obtained from samples of various A. pompejana epibiont biomass and hydrothermal chimney While we were able to cultivate hydrothermal vent epsilon samples as listed in Table 1. Lane 9, positive controls (Am-N in A, Proteobacteria from the A. pompejana episymbiont community as Am-H in B). A slight frown occurred in the gel shown in panel B.
well as from chimney samples, we were unsuccessful in enriching for the dominant filamentous epsilon Proteobacteria phylotypes phylogenetically similar bacteria (35), fill an important niche in found integrated into the hair-like projections on the worm's the environmental habitat of deep-sea hydrothermal vents, dorsal epithelium (5, 14). We found, during the course of this where they may contribute both to an increase in biomass and investigation, that the medium designed for cultivation of epsilons to overall carbon production.
was limited and selected for specific growth of two types of epsi- Two of the epsilons (Am-N and Ex-18.1) described in this lon Proteobacteria. The culturing conditions were restricted by report phylogenetically group with the Sulfurospirillum spp., a temperature range, carbon source used, electron donor-acceptor distinct clade within the epsilon subdivision of Proteobacteria (12, pairs tested, and pH. Any one or a combination of these factors 37, 42). Other members of the Sulfurospirillum group are not able will need to be tested further for potential growth of the free- to grow at 42°C but have pH requirements similar to that of living counterparts of the dominant episymbionts that were de- Am-N. Sulfurospirillum spp. also use a variety of electron tected in chimney samples during our previous investigation (5).
donors and are able to ferment fumarate (42). S. arca- Furthermore, as determined by their relative band intensities by chonense, the closest phylogenetic representative to Am-N, DGGE analysis, neither Am-N nor Am-H was numerically dom- also seems very close metabolically since, like Am-N, it does inant in any of the 13°N A. pompejana samples or chimney sam- not reduce thiosulfate, sulfite, and Fe(III). However, another ples from 9°N. However, a bacterium phylogenetically identical to species of this genus, S. barnesii, is able to use a diverse spec- Am-H was detected by DGGE analysis in a 10⫺7 dilution of a trum of electron acceptors, including arsenate, selenate, and hydrothermal vent chimney enrichment for Fe(III) reducers from Fe(III) (18, 27, 42), indicating the potential of diverse physio- the same cruise at 13°N (38). Additionally, phylogenetically sim- logical abilities of these bacteria, an adaptation certainly ap- ilar deeply branching bacteria have been observed at other hy- propriate for organisms thriving in deep-sea hydrothermal vent drothermal vent sites devoid of A. pompejana specimens (35). It seems likely, then, that Am-H (or phylogenetically similar bacte- ria) exists in higher numbers in the chimney samples than on A. pompejana specimens from 13°N EPR.
Bacteria belonging to the epsilon subdivision of the Proteo- bacteria are clearly important in the ecology of hydrothermal vents, as indicated by their dominance in several molecular surveys (4, 14, 25, 35). The enrichment of autotrophic and heterotrophic epsilon Proteobacteria contributes to our under- standing of carbon and sulfur cycling in hydrothermal vent environments. Our successful culturing of four phylogeneti- cally distinct epsilon Proteobacteria from different hydrother- mal vent environments paves the way for more biochemical testing of these isolates and further attempts to culture addi- tional epsilons from these extreme environments.
FIG. 4. DGGE of positive PCR products obtained after amplifica- This research was supported by grants to S.C.C. from the LEXEN tion using universal primers. Lanes 1 to 11, separated amplification initiative (OCE-9907666) and the Delaware Sea Grant Program (R/ products obtained from samples of various A. pompejana epibiont B37) as well as a LEXEN initiative grant to G. Luther and S.C.C.
biomass and hydrothermal chimney samples as listed in Table 1. Lanes (OCE-9729784). The Amistad cruise was organized by the Centre 12 and 13, positive controls. Arrows indicate bands that were reampli- National de la Recherche Scientifique.
fied for DNA sequencing.
We gratefully acknowledge the following people for their technical CAMPBELL ET AL.
APPL. ENVIRON. MICROBIOL.
assistance: L. Waidner, S. L'Haridon, D. Dalton, and M. Cottrell. We hydrothermal vent waters. J. Environ. Manage. 62:61–66.
thank K. Coyne, C. DiMeo, and two anonymous reviewers for critically 23. Luther, G. W., T. F. Rozan, M. Taillefert, D. B. Nuzzio, C. Di Meo, T. M.
reviewing the manuscript. We thank the captains and crews of the R/Vs Shank, R. A. Lutz, and S. C. Cary. 2001. Chemical speciation drives hydro-
Atlantis and L'Atalante and especially the pilots of the DSVs Alvin and thermal vent ecology. Nature 410:813–816.
Nautile for their essential roles in the collection of specimens.
24. Macy, J. M., I. Schroder, R. K. Thauer, and A. Kroger. 1986. Growth the
Wolinella succinogenes on H2S plus fumarate and on formate plus sulfur as energy-sources. Arch. Microbiol. 144:147–150.
25. Moyer, C. L., F. C. Dobbs, and D. M. Karl. 1995. Phylogenetic diversity of
1. Amann, R. I., W. Ludwig, and K. H. Schleifer. 1995. Phylogenetic identifi-
the bacterial community from a microbial mat at an active, hydrothermal cation and in situ detection of individual microbial cells without cultivation.
vent system, Loihi Seamount, Hawaii. Appl. Environ. Microbiol. 61:1555–1562.
Microbiol. Rev. 59:143–169.
26. Olsen, G. J. 1988. Phylogenetic analysis using ribosomal RNA. Methods
2. Blochl, E., R. Rachel, S. Burggraf, D. Hafenbradl, H. W. Jannasch, and K. O.
Stetter. 1997. Pyrolobus fumarii, gen. and sp. nov., represents a novel group
27. Oremland, R. S., J. S. Blum, C. W. Culbertson, P. T. Visscher, L. G. Miller,
of archaea, extending the upper temperature limit for life to 113 degrees C.
P. Dowdle, and F. E. Strohmaier. 1994. Isolation, growth, and metabolism of
an obligately anaerobic, selenate-respiring bacterium, strain SES-3. Appl.
3. Brosius, J., T. J. Dull, D. D. Sleeter, and H. Noller. 1981. Gene organization
Environ. Microbiol. 60:3011–3019.
and primary structure of a ribosomal RNA operon from Escherichia coli. J.
28. Pfenning, N., and H. Biebl. 1981. The dissimilatory sulfur-reducing bacteria,
Mol. Biol. 148:107–127.
p. 941–947. In M. P. Starr, H. Stolp, H. G. Truper, A. Balows, and H. G.
4. Campbell, B. J., and S. C. Cary. 2001. Characterization of a novel spirochete
Schlegel (ed.), The prokaryotes, vol. 1, Springer-Verlag, New York, N.Y.
associated with the hydrothermal vent polychaete annelid Alvinella pompe- 29. Polz, M. F., and C. M. Cavanaugh. 1995. Dominance of one bacterial phy-
jana. Appl. Environ. Microbiol. 67:110–117.
lotype at a mid-Atlantic Ridge hydrothermal vent site. Proc. Natl. Acad. Sci.
5. Cary, S. C., M. T. Cottrell, J. L. Stein, F. Camacho, and D. Desbruye res.
1997. Molecular identification and localization of a filamentous symbiotic 30. Porter, K. G., and Y. S. Feig. 1980. The use of DAPI for identifying and
bacteria associated with the hydrothermal vent annelid Alvinella pompejana.
counting aquatic microflora. Limnol. Oceangr. 25:943–948.
Appl. Environ. Microbiol. 63:1124–1130.
31. Prieur, D., and C. Jeanthon. 1987. Preliminary study of heterotrophic bac-
6. Cline, J. D. 1969. Spectrophotometric determination of hydrogen sulfide in
teria isolated from deep sea hydrothermal vent invertebrates: Alvinella pompe- naturals waters. Limnol. Oceanogr. 14:454–458.
jana (Polychaete) and Bathymodiolus thermophilus (Bivalve). Symbiosis 4:87–98.
7. Cottrell, M. T., and S. C. Cary. 1999. Diversity of dissimilatory bisulfite re-
32. Prieur, D., S. Chamroux, P. Durand, G. Erauso, P. Fera, C. Jeanthon, L. Le
ductase genes of bacteria associated with the deep-sea hydrothermal vent poly- borgne, G. Me´vel, and P. Vincent. 1990. Metabolic diversity in epibiotic flora
chaete annelid Alvinella pompejana. Appl. Environ. Microbiol. 65:1127–1132.
associated with the pompeii worms, Alvinella pompejana and Alvinella cau- 8. Dempster, E. L., K. V. Pryor, D. Francis, J. E. Young, and H. J. Rogers. 1999.
data (Polychaeta: Annelida) from deep-sea hydrothermal vents. Mar. Biol.
Rapid DNA extraction from ferns for PCR-based analyses. Biotechniques 33. Raguenes, G., P. Pignet, G. Gauthier, A. Peres, R. Christen, H. Rougeaux, G.
9. Durand, P., A. L. Reysenbach, D. Prieur, and N. Pace. 1993. Isolation and
Barbier, and J. Guezennec. 1996. Description of a new polymer-secreting
characterization of Thiobacillus hydrothermalis sp. nov., a mesophilic obli- bacterium from a deep-sea hydrothermal vent, Alteromonas macleodii subsp.
gately chemolithotrophic bacterium isolated from a deep-sea hydrothermal fijiensis, and preliminary characterization of the polymer. Appl. Environ.
vent in Fiji Basin. Arch. Microbiol. 159:39–44.
10. Edmond, J. M., and K. L. Von Damm. 1985. Chemisty of ridge crest hot
34. Rath, J., K. Y. Wu, G. J. Herndl, and E. F. DeLong. 1998. High phylogenetic
springs. Biol. Soc. Wash. Bull. 6:43–47.
diversity in a marine-snow-associated bacterial assemblage. Aquat. Microb.
11. Finster, K., W. Liesack, and B. Thamdrup. 1998. Elemental sulfur and
thiosulfate disproportionation by Desulfocapsa sulfoexigens sp. nov., a new 35. Reysenbach, A. L., K. Longnecker, and J. Kirshtein. 2000. Novel bacterial
anaerobic bacterium isolated from marine surface sediment. Appl. Environ.
and archaeal lineages from an in situ growth chamber deployed at a mid- Atlantic Ridge hydrothermal vent. Appl. Environ. Microbiol. 66:3798–3806.
12. Finster, K., W. Liesack, and B. J. Tindall. 1997. Sulfurospirillum arca-
36. Rozan, T. F., S. M. Theberge, and G. Luther. 2000. Quantifying elemental
chonense sp. nov., a new-microaerophilic sulfur-reducing bacterium. Int. J.
sulfur (S0), bisulfide (HS⫺) and polysulfides (S 2⫺ ) using a voltammetric Syst. Bacteriol. 47:1212–1217.
method. Anal. Chim. Acta 415:175–184.
13. Gevertz, D., A. J. Telang, G. Voordouw, and G. E. Jenneman. 2000. Isolation
37. Schumacher, W., P. M. H. Kroneck, and N. Pfennig. 1992. Comparative
and characterization of strains CVO and FWKOB, two novel nitrate-reduc- systematic study on "Spirillum" 5175, Campylobacter, and Wolinella spe- ing, sulfide-oxidizing bacteria isolated from oil field brine. Appl. Environ.
cies—description of "Spirillum" 5175 as Sulfurospirillum deleyianum gen., nov. spec. nov. Arch. Microbiol. 158:287–293.
14. Haddad, M. A., F. Camacho, P. Durand, and S. C. Cary. 1995. Phylogenetic
38. Slobodkin, A., B. J. Campbell, S. C. Cary, E. Bonch-Osmolovskaya, and C. Jean-
characterization of the epibiotic bacteria associated with the hydrothermal thon. 2001. Thermophilic Fe(III)-reducing microorganisms inhabit deep-sea
vent polychaete Alvinella pompejana. Appl. Environ. Microbiol. 61:1679–1687.
hydrothermal vents on the east Pacific rise. FEMS Microbiol. Ecol. 36:235–243.
15. Jannasch, H. W., C. O. Wirsen, D. C. Nelson, and L. A. Robertson. 1985.
39. Smith, S. W., R. Overbeek, G. Olsen, C. Woese, P. M. Gillevet, and W.
Thiomicrospira crunogena sp. nov., a colorless, sulfur-oxidizing bacterium Gilbert. 1992. Genetic data environment and the Harvard genome database:
from a deep-sea hydrothermal vent. Int. J. Syst. Bacteriol. 35:422–424.
genome mapping and sequencing. Cold Spring Harbor Laboratory, Cold 16. Jeanthon, C., and D. Prieur. 1990. Susceptibility to heavy metals and char-
Spring Harbor, N.Y.
acterization of heterotrophic bacteria isolated from two hydrothermal vent 40. Snaidr, J., R. Amann, I. Huber, W. Ludwig, and K. H. Schleifer. 1997.
polychaetes, Alvinella pompejana and Alvinella caudata. Appl. Environ. Mi- Phylogenetic analysis and in situ identification of bacteria in activated sludge.
Appl. Environ. Microbiol. 63:2884–2896.
17. Juniper, S. K., and J. Sarrizan. 1995. Interaction of vent biota and hydro-
41. Stetter, K. O. 1996. Hyperthermophilic procaryotes. FEMS Microbiol. Rev.
thermal deposits: present evidence and future experimentation, p. 178–193.
In S. E. Humpris, R. A. Zierenberg, L. S. Mullineaux, and R. E. Thomson 42. Stolz, J. F., D. J. Ellis, J. S. Blum, D. Ahmann, D. R. Lovley, and R. S.
(ed.), Seafloor hydrothermal systems: physical, chemical, biological, and Oremland. 1999. Sulfurospirillum barnesii sp. nov. and Sulfurospirillum ar-
geological interactions. American Geophysical Union, Washington, D.C.
senophilum sp. nov., new members of the Sulfurospirillum clade of the epsilon 18. Laverman, A. M., J. S. Blum, J. K. Schaefer, E. J. P. Phillips, D. R. Lovley,
Proteobacteria. Int. J Syst. Bacteriol. 49:1177–1180.
and R. S. Oremland. 1995. Growth of strain SES-3 with arsenate and other
43. Taylor, C. D., and C. O. Wirsen. 1997. Microbiology and ecology of filamen-
diverse electron acceptors. Appl. Environ. Microbiol. 61:3556–3561.
tous sulfur formation. Science 277:1483–1485.
19. L'Haridon, S., V. Cilia, P. Messner, G. Raguenes, A. Gambacorta, U. B.
44. Taylor, C. D., C. O. Wirsen, and F. Gaill. 1999. Rapid microbial production
Sleytr, D. Prieur, and C. Jeanthon. 1998. Desulfurobacterium thermolithotro-
of filamentous sulfur mats at hydrothermal vents. Appl. Environ. Microbiol.
phum gen. nov., sp. nov., a novel autotrophic, sulpfur-reducing bacterium iso- lated from a deep-sea hydrothermal vent. Int. J. Syst. Bacteriol. 48:701–711.
45. Watanabe, K., Y. Kodama, K. Syutsubo, and S. Harayama. 2000. Molecular
20. Li, L. N., C. Kato, and K. Horikoshi. 1999. Bacterial diversity in deep-sea
characterization of bacterial populations in petroleum-contaminated sediments from different depths. Biodivers. Conserv. 8:659–677.
groundwater discharged from underground crude oil storage cavities. Appl.
21. Lovley, D. R., and E. J. P. Phillips. 1986. Organic-matter mineralization with
Environ. Microbiol. 66:4803–4809.
reduction of ferric iron in anaerobic sediments. Appl. Environ. Microbiol.
46. Widdel, F. 1983. Methods for enrichment and pure culture isolation of
filamentous gliding sulfate-reducing bacteria. Arch. Microbiol. 134:282–285.
22. Luther, G. W., B. T. Glazer, L. Hohmann, J. I. Popp, M. Taillefert, T. F.
47. Widdel, F., and F. Bak. 1992. Gram-negative mesophilic sulfate-reducing
Rozan, P. J. Brendel, S. M. Theberge, and D. B. Nuzzio. 2001. Sulfur spe-
bacteria, p. 3352–3378. In A. Balows, H. G. Truper, M. Dworkin, W. Harder, ciation monitored in situ with solid state gold amalgam voltammetric micro- and K. H. Schleifer (ed.), The prokaryotes, vol. IV. Springer-Verlag, New electrodes: polysulfides as a special case in sediments, microbial mats and

Source: http://www.joelkostka.net/pubs/CampbellAEM01.pdf