Fisiologia.buap.mx

Cell Mol Neurobiol Regulation of CaV3.1 Channels by Glucocorticoids Traudy Avila Æ Oscar Herna´ndez-Herna´ndez Æ Ange´lica Almanza ÆMario Bermu´dez de Leo´n Æ Mercedes Urban Æ Enrique Soto Æ Bulmaro Cisneros ÆRicardo Felix Received: 27 April 2009 / Accepted: 1 June 2009Ó Springer Science+Business Media, LLC 2009 The activity of low voltage-activated Ca2? the control of GCs, and if their actions are mediated by (CaV3) channels is tightly coupled to neurotransmitter and transcriptional and/or post-transcriptional mechanisms.
hormone secretion. Previous studies have shown that CaV3 RT-PCR and western blot analyses showed that CaV3.1 but channels are regulated by glucocorticoids (GCs), though not CaV3.2 and CaV3.3 channels is expressed in the GH3 the mechanism underlying channel regulation remains cells, and patch clamp recordings confirmed that Ca2? unclear. Here, using the pituitary GH3 cell line as a model, currents through low voltage-activated channels were we investigated whether CaV3 channel expression is under decreased after chronic treatment with GCs. Consistentwith this, total plasma membrane expression of CaV3.1protein as analyzed by cell-surface biotinylation assays and Traudy Avila and Oscar Herna´ndez-Herna´ndez contributed equally to semi-quantitative western blotting was also down-regu- lated, while quantitative real-time RT-PCR analysis Electronic supplementary material The online version of this revealed a significant decrease of CaV3.1 mRNA expres- article ) contains supplementary sion in the treated cells. In contrast, patch-clamp recordings material, which is available to authorized users.
on HEK-293 cells stably expressing recombinant CaV3.1 channels showed that Ca2? currents were not affected by Department of Physiology, Biophysics and Neuroscience, Center GC treatment. These results suggest that decreased tran- for Research and Advanced Studies of the National Polytechnic scription is a likely mechanism to explain the inhibitory Institute, Cinvestav-IPN, Mexico City, Mexico actions of GCs on the functional expression of native O. Herna´ndez-Herna´ndez
A. Almanza
M. Urban
CaV3.1 channels.
R. Felix (&)Department of Cell Biology, Cinvestav-IPN, Avenida IPN 2508, Ca2? channels
CaV3.1
Cortisol
Colonia Zacatenco, 07300 Mexico City, Mexico Dexamethasone
GH3 cells
HEK-293 cells A. Almanza
E. SotoInstitute of Physiology, University of Puebla, Puebla, Mexico M. Bermu´dez de Leo´nDivision of Genetics, Northeast Biomedical Research Center, Glucocorticoids (GCs) are steroid hormones synthesized in Mexican Institute of Social Security (IMSS), Monterrey, Mexico the adrenal cortex, and circulated systemically to regulate avariety of physiologic processes, including cell develop- ment and metabolism (Zhou and Cidlowski ). Given Department of Genetics and Molecular Biology, Cinvestav-IPN,Mexico City, Mexico their lipophilicity, GCs are thought to diffuse across theplasma membrane. Once in the cytoplasm, they interact with the glucocorticoid receptor (GR) which mediates most of the hormone-induced actions (Zhou and Cidlowski Inserm U781, Clinique Maurice Lamy, Hopital Necker-EM, 149rue de Se vres, 75015 Paris, France ; Kassel and Herrlich Following activation, the Cell Mol Neurobiol GR is translocated to the nucleus where it interacts with constituting the L-type channels, almost nothing is known specific sequences called glucocorticoid-responsive ele- regarding the regulation of LVA channel expression by ments (GREs) in target gene promoters to enhance tran- GCs. Therefore, the aim of the present study was to spe- scription. Alternatively, they can bind to negative GREs cifically determine whether long-term exposure to GCs can (nGREs) to suppress transcription. Transcriptional modu- affect CaV3 (LVA) channel expression. To this end, total lation by GR can be also achieved through its cross-talk RNA and proteins were isolated from clonal pituitary GH3 with other transcription factors (Kassel and Herrlich cells after a 6 days treatment with vehicle or GCs (HC or It is well known that exposure to GCs can modulate Dex). Using reverse transcriptase-polymerase chain reac- voltage-gated Ca2? (CaV) channels. CaV channels are tion (RT-PCR), quantitative real-time RT-PCR, and semi- transmembrane proteins that open in response to membrane quantitative western blot we examine transcript and protein depolarization and allow Ca2? ions to enter the cell cou- expression changes of the LVA CaV3.1 channel. The pling electrical signals in the membrane to physiologic molecular and biochemical studies were followed by events within the cell (Catterall et al. ). According to functional experiments in which we examined whether their electrophysiological properties, CaV channels have chronic treatment with GCs targets the functional expres- been divided into low and high voltage-activated (LVA and sion of recombinant CaV3.1 channels heterologously HVA, respectively) channels (Catterall et al. expressed in the HEK-293 cell line.
Molecular studies have established the a1 protein as thepermeation pathway for all CaV channels, and identifiedseven different genes encoding HVA CaV channel a1 Materials and Methods subunits (CaV1.1–CaV1.4 and CaV2.1–CaV2.3) and threegenes coding LVA channels (CaV3.1–CaV3.3). In addition to the a1 subunit, HVA channels also comprise auxiliarysubunits a2d, b, and c (Catterall et al. ; Felix ).
Rat pituitary-derived GH3 cells (American Type Culture A number of molecular and functional studies have Collection; ATCC Number: CCL-82.1) have been adapted demonstrated that acute or chronic treatment with hydro- to grow in culture using Ham's F-10 Nutrient Mixture cortisone (HC; or cortisol) or dexamethasone (Dex; a supplemented with 15% horse serum, 2.5% fetal bovine potent synthetic GC) significantly affect Ca2? currents in serum, 2 mM L-glutamine, and 100 UI/ml–100 lg/ml many cell types. GR activation with GCs results in larger penicillin-streptomycin. Cells were incubated in a humid amplitudes of Ca2? currents through HVA channels, as atmosphere of 5% CO2-95% O2 at 37°C. The incubation measured by voltage-clamp techniques (Obejero-Paz et al.
medium was changed every 2 days. Cells were harvested ; Wang et al. Chameau et al. possibly by once per week by treatment with a trypsin-EDTA solution, increasing the number of channels at the cell surface and reseeding was carried out at 20% of the original den- (Hayashi et al. ; Kato et al. Obejero-Paz et al.
sity. Human embryonic kidney (HEK-293) cells stably ). This has been proposed to be a result of augmen- expressing the CaV3.1a channel (Lee et al. Cribbs tation in the expression levels of the messenger RNA of the et al. were grown as described elsewhere (Avila et al.
CaV1.2 (Fomina et al. ; Takimoto et al. ; Gu et al.
), CaV1.3 (Takimoto et al. ; Gu et al. and GH3 and HEK-293 cells were initially grown for 1 day b4 (Chameau et al. channel subunits.
in standard culture medium. Afterward cells remained in The response of LVA channels to GC varies among the standard medium (control) or were cultured in medium different cell types with some cells like hippocampal supplemented with 1 or 5 lM HC and Dex, respectively.
neurons and bone marrow cells showing an increase in These media were subsequently replenished every 24 h.
currents (Karst et al. Publicover et al. ), while These glucocorticoids concentrations are known to induce other cell types like PC12 or smooth muscle cells being saturating effects on hormone production in GH cells unaffected (Garber et al. ; Obejero-Paz et al. ; (Naess et al. and according to a dose-response curve Joels et al. ), or even showing a slight decrease (Meza published already (Meza et al. ) they are adequate for et al. ) after GC treatment. Though the reasons for investigating the effects of glucocorticoids on Ca2? chan- these differences are unknown, it might be possible to nel activity.
attribute them to differences in experimental conditions orcell type variability.
Although semi-quantitative analyses of RNA expression have revealed that GC-mediated increases in HVA currents After 6 days in culture, GH3 and HEK-293 cells were are associated with parallel shifts in the relative expression subjected to the standard whole cell patch-clamp technique of the ion-conducting as well as auxiliary subunits using an Axopatch 200B amplifier as described previously Cell Mol Neurobiol Table 1 Sets of primers to V3 channels genes F: GGTTTGGGTACCATGAACTA R: GTAAACTCATAGACTCCGTG F: ITATCTGCTCCCTGACTGG R: GAGAACTGGGITGCTATGAC (Avila et al. Current signals were filtered at 2 kHz, digitized at 5.71 kHz and analyzed with pClamp software.
Data were leak subtracted on line by a P/4 protocol. The HEK-293 and GH3 cells were washed with PBS and sus- bath recording solution contained (in mM) 10 BaCl2, 125 pended in RIPA buffer containing proteases inhibitors.
TEA-Cl, 10 HEPES and 10 glucose (pH 7.3). The internal Aliquots of 100 lg of protein were mixed with sample solution consisted of (in mM) 110 CsCl, 5 MgCl2, 10 buffer (50 mM Tris–HCl [pH 6.8], 2% SDS, 10% glycerol, EGTA, 10 HEPES, 4 Na-ATP and 0.1 GTP (pH 7.3).
5% DTT, 0.01% bromophenol blue) and boiled for 5 min.
Proteins were resolved in 7.5% SDS–polyacrylamide gels Total RNA Isolation and Standard RT-PCR and transferred to nitrocellulose membranes. After block-ing with non-fat milk supplemented with 0.2% Tween 20, Total RNA was extracted from GH3 cells by TRIzol membranes were incubated overnight with the primary reagent. The one-step RT-PCR system combining super- anti-CaV3 antibodies (Table washed in TBS-T (10 mM script reverse transcriptase (SSII RT) with platinum Taq- Tris–HCl, 0.15 M NaCl, 0.05% tween 20), incubated with polymerase was used as described previously (Avila et al.
the secondary antibodies (Table ) and developed with the ). The sequences of oligonucleotide primers used are Amersham ECL reagent. As a protein loading control, given in Table . RT-PCR products were sequenced on an membranes were striped and incubated with a mouse monoclonal anti-actin antibody. Semi-quantitative analysiswas carried out by densitometry using the Kodak digital Quantitative Real-Time RT-PCR Science ID v.2.0 system program. These and all otherbiochemical experiments were repeated at least three times.
The mRNA levels of the rat ion-conducting CaV3.1 subunit(AF027984) were measured by quantitative RT-PCR as Cell-Surface Biotinylation Assays previously described (Andrade et al. Briefly, 1 lg oftotal RNA was primed with random hexanucleotides and Cell surface labeling was performed using a commercial kit reverse transcribed by M-MLV transcriptase. The primers (Cat. # 89881; Thermo Scientific Pierce, Rockford, IL).
and the probes are given in Table . PCR reactions were Briefly, intact GH3 cells were washed twice with cold PBS performed using the TaqMan Universal PCR Master Mix in and labeled with 0.25 mg/ml of the membrane-impermeant a total volume of 25 ll containing 400 nM of each oligo- biotinylation reagent sulfo-NHS-SS-biotin for 30 min at nucleotide, 200 nM of the TaqMan probe, and 3 ll of 4°C with gentle shaking. Quenching solution was added to cDNA. Reactions were carried out in 96-well plates on a stop the reaction. Cells were scraped and washed two times 7000 Perkin Elmer Sequence Detector. The PCR cycling with cold TBS to remove unbound biotin. Cells were then conditions included an initial step at 50°C for 2 min and suspended in lysis buffer containing a protease inhibitor 95°C for 10 min, followed by 40 cycles of 98°C for 15 s cocktail called Complete (Roche Diagnostics; Indianapolis, and a final step of 60°C for 1 min. The expression of the IN) that contains chymotrypsin, pancreas extract, papain, 18S ribosomal RNA (r18S) gene was analyzed as endog- pronase, thermolysin, and trypsin, and disrupted by soni- enous control.
cation using five 3s bursts. After incubation on ice during Table 2 Sets of primers to amplify CaV3 channel genes from GH3 cells using real-time PCR Cell Mol Neurobiol Table 3 Antibodies used in this Alomone Labs (Jerusalem, Israel) Santa Cruz Biotechnology (USA) Alomone Labs (Jerusalem, Israel) D. Mornet (INSERMERI25, France) M. Hernandez (Cinvestav-IPN, Mexico) Santa Cruz Biotechnology (USA) Amersham Biosciences (UK) Anti mouse HRP-conjugated Amersham Biosciences (UK) 30 min, lysates were clarified and biotinylated proteins (Supplemental Fig. 1). In contrast, GC chronic treatment recovered by incubation with immobilized NeutrAvidin- decreased IBa densities obtained at -20 mV, but did not gel. The bound proteins were released by incubating with have a major effect on IBa densities at ?20 mV (Fig. SDS–PAGE sample buffer (62.5 mM Tris–HCl, pH 6.8, Hence, culturing the GH3 cells during 5–6 days in the 1% SDS, 10% glycerol, 50 mM DTT) quantified and presence of 1 lM Dex or 5 lM HC resulted in *30% analyzed by western blot by using the anti-CaV3.1 antibody decrease of current density at -20 mV (from a control (Table ). As a protein loading control, membranes were value of -3.7 ± 0.4 pA/pF to -2.6 ± 0.3 and -2.8 ± 0.2 striped and incubated with anti-b-dystroglycan antibody. A pA/pF, respectively), with no significant changes in current mouse monoclonal anti-b-actin antibody was used to verify densities at ?20 mV (control value of -11 ± 1 pA/pF and membrane proteins purity (Table ). Protein bands in -11.6 ± 1.5 and -10.9 ± 1.1 pA/pF for Dex and HC immunoblots were quantified by densitometry using the treated cells, respectively). These findings corroborate Kodak digital Science ID v.2.0 system program.
previous data showing that chronic exposure to these hor-mones selectively decreases the functional activity of LVACa2? channels in GH3 cells (Meza et al. Standard RT-PCR was then performed on total RNA to examine what sub-types of CaV3 channels were expressed To validate GH3 cells as a model, we initially characterized in GH3 cells, using sequence-specific primers. As shown in the macroscopic currents using Ba2? as charge carrier and Fig. , a PCR fragment of the predicted size was detected then investigated whether CaV3 (LVA) channel expression using primers for the CaV3.1 sequence. This PCR fragment in this cell line was under the control of GCs. Whole cell co-migrated with the product amplified from rat brain and patch-clamp recordings confirmed the expression of two HEK-293 cells stably transfected with the CaV3.1 cDNA types of Ca2? currents in the plasma membrane of these (not shown), which served as a positive control. The cells as described previously (Meza et al. Whendepolarizations were carried out from a holding potential(Vh) of -80 mV to -20 mV, the current was small andtended to inactivate during a 200-ms pulse. This currentflows mostly through LVA channels. Larger depolariza-tions to ?20 mV induced the opening of additional LVAchannels and also recruited HVA channels, resulting in alarger inward current that inactivates rapidly at first andthen more slowly. The slowly inactivating phase of thecurrent is carried almost exclusively by HVA channels.
We next investigated the regulation of these currents after acute (10–15 min) or chronic (5–6 days) treatmentwith HC or Dex. Macroscopic Ba2? current (IBa) throughCa2? channels was evoked by depolarizing voltage steps Fig. 1 Chronic treatment of GH3 cells with GCs decreases whole-cell from a Vh of -80 mV and the maximum amplitude Ca2? currents through LVA channels. Comparison of the percentage obtained at -20 mV and ?20 mV (normalized by C of peak Ba2? current (through Ca2? channels) densities at -20 mV were compared between GH and Ba2? current densities measured at the end of activating pulses to 3 cells in the control condition ?20 mV in cells exposed to 5 lM dexamethasone (Dex) or and in cells treated with GCs. IBa densities after acute hydrocortisol (HC) for 5–6 consecutive days. Data are given as treatment were similar in control and non-treated cells mean ± S.E.M. (n = 7–24 cells in each experimental condition)

Cell Mol Neurobiol identity of these amplicons was confirmed by sequencing.
In contrast, no PCR products could be amplified from theGH3 cells RNA when primers for the CaV3.2 sequencewere used, though these primers did amplify productscorresponding to the predicted size of cDNAs from ratbrain CaV3.2 (Fig. ) and from HEK-293 cells stablyexpressing this type of channel (not shown). Likewise, theuse of primers for the CaV3.3 sequence did not result in theproduction of a specific product from GH3 cells. Theseresults corroborate previous reports showing that one of thethree isoforms (CaV3.1) is expressed in the GH3 cells(Glassmeier et al. ; Mudado et al. In contrast toour findings, Mudado et al. ) reported the expressionof CaV3.3 channels in the GH3 cells, however their PCRexperiments revealed the presence of multiple hybridiza-tion bands with the CaV3.3 oligonucleotides, and no PCRproducts were apparently sequenced.
In order to investigate the expression of the LVA channels at the level of protein, membranes derived fromGH3 cells were screened for the presence of CaV3 channelsusing specific antibodies. The results were concordant with Fig. 3 CaV3 protein channel expression in GH3 cells. a CaV3.1 the RT-PCR analyses and showed that GH protein expression was analyzed by western blot in GH3 or rat brain.
b Analysis of CaV3.2 and CaV3.3 proteins in GH3 cells or HEK-293 CaV3.1 but not CaV3.2 and CaV3.3 channels. As can be cells stably expressing CaV3.2 and CaV3.3 channels. CaV proteins seen in Fig. a, western blot analysis showed an immu- were detected with specific polyclonal anti-CaV3 antibodies (Table ) noreactive protein with a molecular weight above 250 kDa,consistent with the predicted size of CaV3.1. Antibodyreactivity with the CaV3.1 protein from GH3 cells was did recognize proteins corresponding to the predicted compared with that of the protein expressed in the rat brain.
molecular weight in HEK-293 cells stably expressing the Antibodies against CaV3.1 channels recognized the corre- corresponding channels (Fig. sponding expressed protein with similar molecular size.
Using a polyclonal antibody against the N-terminus of The specificity of the CaV3.1 signal in GH3 cells was CaV3.1 channel, we next studied whether chronic GC evaluated using antibodies preadsorbed with its corre- treatment (5–6 days) affected protein expression. Both sponding antigenic synthetic peptide. There was no signal plasma membrane and intracellular expression of the for the CaV3.1 channels when the primary antibody was CaV3.1 protein was analyzed. We first examined if the preadsorbed (Fig. Likewise, no immunoreactivity membrane localization of CaV3.1 channels was altered could be found from GH3 cells when antibodies for CaV3.2 using a non-membrane permeant agent (sulfo-NHS-SS- and CaV3.3 channels were used, although these antibodies biotin) that biotinylates surface proteins and precipitatedthe proteins with avidin-linked streptavidin beads. Boundproteins were eluted and subjected to western blot analysis.
As shown in Fig. , the expression of biotinylated CaV3.1protein was significantly decreased in the GC treated cells.
The enrichment of cell membrane proteins in the biotin-ylated fractions and equal amounts of loaded proteins indifferent samples were confirmed by reprobing the blotswith an anti-b-dystroglycan antibody, a membrane marker.
Likewise, the biotinylated membrane fraction was notcontaminated by non-plasma membrane proteins becauseactin, an intracellular protein, was not detected in the Fig. 2 CaV3 channel mRNA expression in GH3 cells. The presence biotinylated fractions but was clearly detected in corre- of CaV3 transcripts was probed by standard RT-PCR using cDNA sponding cell lysates (total protein; Fig. a). These data from rat brain as a positive control. MWM denotes molecular weights suggested that chronic treatment with GCs reduces the of the standards on the left. -RT indicates reactions run withoutreverse transcriptase surface expression of CaV3.1 channels in GH3 cells.

Cell Mol Neurobiol Fig. 4 Changes in CaV3.1 protein membrane expression in GH3 cellsinduced by chronic treatment with GCs. a Representative cell surfacebiotinylation assay using an anti-CaV3.1 specific antibody. b Densi-tometric quantification of three repetitions of the experiment shown in Fig. 5 Changes in CaV3.1 total protein expression by GCs in GH3 a. Asterisk denotes significant differences (P 0.05) between control cells. a Total cell extracts from control and GC-treated cells were and treated cells analyzed by western-blot using an anti-CaV3.1 specific antibody.
Membranes were stripped and reprobed with an anti-actin antibody asa protein loading control. b Band signal intensities of CaV3.1 werenormalized to actin levels to obtain the relative expression of the The preceding data suggested that the hormone treat- CaV3.1 channels. Asterisk denotes significant differences (P 0.05) ment may alter the trafficking of newly synthesized CaV3.1 between control and treated cells proteins to the plasma membrane, resulting in a chronicdown-regulation of functional channel expression. There- expression after GC treatment (Fig. ) and with the alter- fore, we next quantified the relative levels of these proteins ations in LVA current density (Fig. ).
in whole cell lysates by semi-quantitative western blot The possibility exists, however, that GCs may be experiments (Fig. ). The result of this analysis showed affecting LVA currents by acting through a post-tran- that the expression of the CaV3.1 protein was significantly scriptional modification of the CaV3.1 channel protein. To decreased to *60% of its control value in the cells treated examine this, we compared the actions of Dex and HC on with Dex and HC, which is consistent with the data the whole-cell currents recorded in HEK-293 cells stably obtained in the functional and biotinylation assays.
expressing CaV3.1 channels (Lee et al. Cribbs et al.
Taken as a whole, our observations suggested a tran- ). In this cell line, the expression of the channels is scriptional mechanism by which GCs down-regulate driven by the cytomegalovirus promoter (Cribbs et al.
CaV3.1 expression. To test this hypothesis, we next ), and therefore the transcriptional actions of the GCs assessed the mRNA levels of this channel using quantita- observed on native CaV3.1 channels may be bypassed.
tive PCR (qPCR). GH3 cells were treated 6 days with Consequently, the post-transcriptional effects of the GCs vehicle, Dex or HC (1 and 5 lM, respectively) before RNA on the recombinant channels may be studied separately.
isolation. As expected from results obtained in RT-PCR The results of this analysis show that the peak amplitude of standard assays, using qPCR we detected transcripts of the currents was very similar in both cell types (Supple- CaV3.1 but not of CaV3.2 or CaV3.3 channels. More mental Fig. 2). Likewise, the time course of the current importantly, the result of these series of experiments traces was almost identical in both experimental condi- indicated that GC treatment caused a significant decrease tions, suggesting that the activation and inactivation rates (of *50%) in the mRNA levels for the CaV3.1 channels of the CaV3.1 channels were not modified by the GC (Fig. which is consistent with decreased channel protein treatment. The steady-state inactivation properties of the

Cell Mol Neurobiol is able to increase the rate of PRL gene transcription inGH3 cells (Day and Maurer Enyeart et al. ).
Likewise, it is well established that the expression levels of LVA channels can be subjected to long-term regulationby different extracellular chemical messengers, including17b-oestradiol, insulin, neural growth factor, transforminggrowth factor-b1, and bone morphogenetic protein-2(Ritchie ; Meza et al. Avila et al. ; Lo´pez-Domı´nguez et al. Of particular interest is thatchronic treatment with GCs decreases LVA current densityin GH3 cells (Meza et al. ). Though the molecularbasis of this regulatory action is unknown, the slow onsetand reversion of this effect suggest a regulation at the levelof gene expression.
Indeed, decreased transcription of the cacna1g gene and the consequent decrease in CaV3.1 channel protein mayaccount for the observed down-regulation of LVA channelsafter GCs treatment. Two sets of experimental evidencesupport this proposal. First, the quantitative PCR (qPCR) Fig. 6 GCs treatment may affect CaV3.1 expression via transcrip- analysis indicated that GCs treatment caused a significant tional alterations. Quantitative PCR results of CaV3.1 mRNA levels decrease (of *50%) in the mRNA levels for the CaV3.1 normalized to r18S RNA expression in control and treated GH3 cells.
Asterisk channels, which is consistent with the reduction in channel denotes significant differences (P 0.05) between control and treated cells protein expression after GCs treatment, and with thedecrease in LVA current density. Second, the gatingproperties of recombinant CaV3.1 channels heterologously channels, characterized by applying a standard double- expressed in HEK-293 were similar before and after GCs pulse protocol, were also very similar between control and treatment. In the HEK cells, the expression of the channels treated cells (Supplemental Fig. 2).
is driven by the cytomegalovirus promoter and is thereforenot subject to the same transcriptional regulation thatcontrols native CaV3.1 channels in GH3 cells. Togetherthese data support the idea that the effects of GCs on CaV3.1 channels are most likely mediated by decreasedtranscription.
Defining the function of voltage-gated Ca2? channels in Based on our observations, we propose that this regu- secretory and other cell types would be facilitated by the lation is the result of alterations in gene expression that identification of extracellular messengers, which preferen- ultimately produce changes in the number of functional tially regulate LVA channel functional expression. LVA channels in the plasma membrane. Indeed, the most com- channels are known to provide one of the major pathways mon mechanism of action of GCs is the transcriptional for Ca2? influx in GH3 clonal pituitary cells (Simasko et al.
regulation of specific target genes via GRs activation. After ; Herrington and Lingle Functional studies translocation to the nucleus, GRs regulate transcription by have shown that GH3 cells fire spontaneous Ca2?-depen- binding to GREs of target genes. The rate of mRNA syn- dent action potentials (SAPs; Scheru¨bl et al. and that, thesis is either enhanced or repressed depending on the whereas HVA channel activity is important for the sequence of a given GRE and presumably on specific upstroke of these SAPs, LVA channel activity is crucial in interactions with other transcription factors (TFs).
regulating the discharge frequency (Llina´s and Yarom For this reason, we searched for potential GREs in a ; Williams et al. ; LeBeau et al. Mansvel- sequence that comprised *1.6 Kb of the genomic DNA der and Kits ).
upstream of and including part of the first exon of the rat Because the LVA channels regulate the firing of SAPs cacna1g gene using the MatInspector software (Genomatix and the electrical activity is coupled with hormone syn- Software Inc; Ann Arbor, MI) and found numerous thesis and secretion in GH3 cells (Schlegel et al. ), it is TF-binding sites (for STAT1, 5 and 6; SMAD3 and 4; reasonable to assume that these channels could be involved NFjB and AP1) potentially relevant for GR signaling, in GH and PRL production. Consistent with this, it has upstream of the transcription initiation site (see Supple- been shown that the influx of Ca2? through LVA channels mental Fig. 3). It should be noted that this sequence has Cell Mol Neurobiol been cloned already and proved to be important during cell differentiation (Bertolesi et al. ). Further studies areneeded to clarify the transcription factors that might be Andrade A, Bermudez de Leon M, Hernandez-Hernandez O, Cisneros B, Felix R (2007) Myotonic dystrophy CTG repeat expansion mediating the GCs-induced regulation of the CaV3.1 alters Ca2? channel functional expression in PC12 cells. FEBS Lett 581:4430–4438 What might be the biologic implications of such chronic Avila T, Andrade A, Felix R (2006) Transforming growth factor-b1 GCs-mediated regulation of Ca and bone morfogenetic protein-2 down-regulate Ca v3.1 channels? Release of expression in mouse C2C12 myoblasts. J Cell Physiol 209:448– anterior pituitary hormones is regulated by diverse extra- cellular messengers, including hypothalamic-hypophysio- Bertolesi GE, Jollimore CA, Shi C, Elbaum L, Denovan-Wright EM, tropic factors, hormones and growth factors. However, the Barnes S, Kelly ME (2003) Regulation of a1G T-type calcium mechanism by which these molecules act on target pitui- channel gene (CACNA1G) expression during neuronal differ-entiation. Eur J NeuroSci 17:1802–1810 tary cells remains to be elucidated. Functional studies have Catterall WA, Perez-Reyes E, Snutch TP, Striessnig J (2005) shown that rat pituitary GH3 cells express both HVA and International Union of Pharmacology. XLVIII. Nomenclature LVA channels and that Ca2? current through LVA chan- and structure-function relationships of voltage-gated calcium nels is reduced by chronic treatment of the cells with GCs channels. Pharmacol Rev 57:411–425 Chameau P, Qin Y, Spijker S, Smit G, Joels M (2007) Glucocorti- (Meza et al. Hence, by diminishing the functional coids specifically enhance L-type calcium current amplitude and expression of LVA channels, GCs may induce a decrease affect calcium channel subunit expression in the mouse hippo- in the SAP firing frequency in GH3 cells. This action may campus. J Neurophysiol 97:5–14 inhibit hormonal production at the level of transcription Cribbs LL, Gomora JC, Daud AN, Lee JH, Perez-Reyes E (2000) Molecular cloning and functional expression of Ca and/or secretion.
T-type calcium channel from human brain. FEBS Lett 466:54–58 GCs have been implicated in attenuating plasma PRL Day RN, Maurer RA (1990) Pituitary calcium channel modulation in humans and abrogating PRL hypersecretion in rodents and regulation of prolactin gene expression. Mol Endocrinol (Piroli et al. ; Hubina et al. ). In GH Enyeart JJ, Biagi B, Day RN (1990) Opposing actions of Bay K 8644 GCs also suppress PRL release elicited by various enantiomers on calcium current, prolactin secretion, and synthe- stimuli (Taylor et al. ). Likewise, elevated GCs sis in pituitary cells. Mol Endocrinol 4:727–735 levels produce a marked impairment in somatic growth Felix R (2005) Molecular regulation of voltage-gated Ca2? channels.
in both rodents and primates. It has been reported that J Recept Signal Transduct Res 25:57–71 Fomina AF, Levitan ES, Takimoto K (1996) Dexamethasone rapidly GCs play an important role in the regulation of GH increases calcium channel subunit messenger RNA expression synthesis and secretion, and it has been reported that and high voltage-activated calcium current in clonal pituitary cortisol inhibited growth hormone-releasing hormone cells. Neuroscience 72:857–862 (GHRH)-stimulated GH release acting through a mech- Garber SS, Hoshi T, Aldrich RW (1989) Regulation of ionic currents in pheochromocytoma cells by nerve growth factor and dexa- anism that involve Ca2? channels (Sartin et al. ; methasone. J Neurosci 9:3976–3987 Watson et al. This is consistent with the fact that Glassmeier G, Hauber M, Wulfsen I, Weinsberg F, Bauer CK, in humans, GCs given chronically are associated with a Schwarz JR (2001) Ca2? channels in clonal rat anterior pituitary variety of negative side effects which limit the prolonged cells (GH3/B6). Pflugers Arch 442:577–587 Gu Y, Preston MR, Magnay J, El Haj AJ, Publicover SJ (2001) use of these hormones as therapeutic agents. Among Hormonally-regulated expression of voltage-operated Ca2? others, GCs treatment affects both the release and the channels in osteocytic (MLO-Y4) cells. Biochem Biophys Res effects of GH at the target sites, hence becoming func- Commun 282:536–542 tional GH antagonists (Mauras Hayashi T, Nakai T, Miyabo S (1991) Glucocorticoids increase Ca2? uptake and [3H]dihydropyridine binding in A7r5 vascular Although genomic mechanisms might be involved in smooth muscle cells. Am J Physiol 261:C106–C114 mediating some of the responses detailed above, Ca2? Herrington J, Lingle CJ (1992) Kinetic and pharmacological proper- homeostasis may also play a significant role. Therefore, ties of low voltage-activated Ca2? current in rat clonal (GH3) more detailed studies on GCs chronic treatment linking pituitary cells. J Neurophysiol 68:213–232 Hubina E, Nagy GM, Toth BE, Ivan G, Gorombey Z, Szabolcs I, their regulatory actions on LVA channels to hormone Kovacs L, Goth MI (2002) Dexamethasone and adrenocortico- production and cell function are warranted.
tropin suppress prolactin secretion in humans. Endocrine18:215–219 This work was supported by funds from Cona- Joels M, Velzing E, Nair S, Verkuyl JM, Karst H (2003) Acute stress cyt to RF. We thank Drs. M. E. Mendoza (Cinvestav-IPN, Mexico) increases calcium current amplitude in rat hippocampus: and J. C. Gomora (IFC-UNAM, Mexico) for the generous gift of the temporal changes in physiology and gene expression. Eur J cell lines and Dr. M. Hernandez (Cinvestav-IPN, Mexico) and NeuroSci 18:1315–1324 D. Mornet (INSERM ERI 25 Muscle et Pathologies, France) for the Karst H, Wadman WJ, Joels M (1994) Corticosteroid receptor- anti-actin and anti-b-dystroglycan antibodies, respectively. We are dependent modulation of calcium currents in rat hippocampal also indebted to J. Arikkath for critically reviewing the manuscript.
CA1 neurons. Brain Res 649:234–242 Cell Mol Neurobiol Kassel O, Herrlich P (2007) Crosstalk between the glucocorticoid glucocorticoid receptors and glucocorticoid negative feedback receptor and other transcription factors: molecular aspects. Mol on prolactin secretion in estrogen-induced pituitary tumors.
Cell Endocrinol 275:13–29 Kato H, Hayashi T, Koshino Y, Kutsumi Y, Nakai T, Miyabo S Publicover SJ, Thomas GP, el Haj AJ (1994) Induction of a low (1992) Glucocorticoids increase Ca2? influx through dihydro- voltage-activated, fast-inactivating Ca2? channel in cultured pyridine-sensitive channels linked to activation of protein kinase bone marrow stromal cells by dexamethasone. Calcif Tissue Int C in vascular smooth muscle cells. Biochem Biophys Res Commun 188:934–941 Ritchie AK (1993) Estrogen increases low voltage-activated calcium LeBeau AP, Robson AB, McKinnon AE, Donald RA, Sneyd J (1997) current density in GH3 anterior pituitary cells. Endocrinology Generation of action potentials in a mathematical model of corticotrophs. Biophys J 73:1263–1275 Sartin JL, Kemppainen RJ, Coleman ES, Steele B, Williams JC Lee JH, Daud AN, Cribbs LL, Lacerda AE, Pereverzev A, Klockner (1994) Cortisol inhibition of growth hormone-releasing hor- U, Schneider T, Perez-Reyes E (1999) Cloning and expression of mone-stimulated growth hormone release from cultured sheep a novel member of the low voltage-activated T-type calcium pituitary cells. J Endocrinol 141:517–525 channel family. J Neurosci 19:1912–1921 Scheru¨bl H, Hescheler J, Bychkov R, Cuber JC, John M, Riecken EO, Llina´s R, Yarom Y (1981) Properties and distribution of ionic Wiedenmann B (1994) Electrical activity and calcium channels conductances generating electroresponsiveness of mammalian in neuroendocrine cells. Ann NY Acad Sci 733:335–339 inferior olivary neurons in vitro. J Physiol 315:569–584 Schlegel W, Winiger BP, Mollard P, Vacher P, Wuarin F, Zahnd GR, Lo´pez-Domı´nguez AM, Espinosa JL, Navarrete A, Avila G, Cota G Wollheim CB, Dufy B (1987) Oscillations of cytosolic Ca2? in (2006) Nerve growth factor affects Ca2? currents via the p75 pituitary cells due to action potentials. Nature 329:719–721 receptor to enhance prolactin mRNA levels in GH3 rat pituitary Simasko SM, Weiland GA, Oswald RE (1988) Pharmacological cells. J Physiol 574(Pt 2):349–365 characterization of two calcium currents in GH3 cells. Am J Mansvelder HD, Kits KS (2000) All classes of calcium channel Physiol 254(3 Pt 1):E328–E336 couple with equal efficiency to exocytosis in rat melanotropes, Takimoto K, Li D, Nerbonne JM, Levitan ES (1997) Distribution, inducing linear stimulus-secretion coupling. J Physiol 526(Pt splicing and glucocorticoid-induced expression of cardiac a1C and a1D voltage-gated Ca2? channel mRNAs. J Mol Cell Cardiol Mauras N (2001) Growth hormone therapy in the glucocorticosteroid- dependent child: metabolic and linear growth effects. Horm Res Taylor AD, Cowell AM, Flower RJ, Buckingham JC (1995) 56(Suppl 1):13–18 Dexamethasone suppresses the release of prolactin from the rat Meza U, Avila G, Felix R, Gomora JC, Cota G (1994) Long-term anterior pituitary gland by lipocortin-1 dependent and indepen- regulation of calcium channels in clonal pituitary cells by dent mechanisms. Neuroendocrinology 62:530–542 epidermal growth factor, insulin, and glucocorticoids. J Gen Wang L, Feng ZP, Duff HJ (1999) Glucocorticoid regulation of Physiol 104:1019–1038 cardiac K? currents and L-type Ca2? current in neonatal mice.
Mudado MA, Rodrigues AL, Prado VF, Beirao PS, Cruz JS (2004) Circ Res 85:168–173 CaV3.1 and CaV3.3 account for T-type Ca2? current in GH3 Watson S, Porter RJ, Young AH (2000) Effect of hydrocortisone on cells. Braz J Med Biol Res 37:929–935 the pituitary response to growth hormone releasing hormone.
Naess O, Haug E, Gautvik K (1980) Effects of glucocorticosteroids Psychopharmacology (Berl) 152:40–46 on prolactin and growth hormone production and characteriza- Williams PJ, MacVicar BA, Pittman QJ (1990) Electrophysiological tion of the intracellular hormone receptors in rat pituitary tumour properties of neuroendocrine cells of the intact rat pars cells. Acta Endocrinol (Copenh) 95:319–327 intermedia: multiple calcium currents. J Neurosci 10:748–756 Obejero-Paz CA, Lakshmanan M, Jones SW, Scarpa A (1993) Effects Zhou J, Cidlowski JA (2005) The human glucocorticoid receptor: one of dexamethasone on L-type calcium currents in the A7r5 gene, multiple proteins and diverse responses. Steroids 70:407– smooth muscle-derived cell line. FEBS Lett 333:73–77 Piroli G, Grillo C, Ferrini M, Diaztorga G, Rey E, Libertun C,

Source: http://www.fisiologia.buap.mx/laboratorios/sensorial/pdf/2009%20Traudy%20et%20al.,%20Cell%20Mol%20Neurobiol_2009.pdf